Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 
ORIGINAL ARTICLE
Ahead of print publication  

Promoter methylation of matrix metallopeptidase 9 in peripheral blood mononuclear cells: A novel biomarker in a promising source for noninvasive colorectal cancer diagnosis


1 Department of Internal Medicine, Division of Gastrointestinal, Faculty of Medicine, Ardabil University of Medical Sciences, Ardabil, Iran
2 Department of Biology, Faculty of Sciences, Arak University, Arak; Fetal Health Research Center, Hope Generation Foundation, Tehran, Iran
3 Department of Genetics and Molecular Biology, Isfahan University of Medical Sciences, Isfahan, Iran
4 Department of Internal Medicine, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
5 Neuroscience Research Center, Faculty of Medicine, Golestan University of Medical Sciences, Gorgan, Iran
6 Department of Medical Genetics, Semnan University of Medical Sciences, Semnan, Iran

Date of Submission05-Dec-2021
Date of Acceptance03-Jan-2022
Date of Web Publication29-Apr-2022

Correspondence Address:
Mohsen Soosanabadi,
Department of Medical Genetics, Semnan University of Medical Sciences, Semnan
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/jcrt.jcrt_2188_21

 > Abstract 


Objectives: Colorectal cancer (CRC) has been described as a “silent disease,” which can be readily treated in most patients when discovered in its early stages. Considering the limitations of the current conventional tests for the diagnosis of CRC, researchers strive to find noninvasive and more valid biomarkers for the early detection of CRC. It has been shown that tumor-specific methylation patterns can also be identified in peripheral blood mononuclear cells (PBMCs) and are reliable sources of methylation analysis for CRC screening.
Materials and Methods: We carried out a quantitative methylation analysis on matrix metallopeptidase 9 (MMP9) promoter using methylation quantification endonuclease-resistant DNA (MethyQESD) method. A total of 70 patients with CRC and 70 normal controls were enrolled in this study for methylation analysis in the PBMCs.
Results: Our findings discovered a considerable hypermethylation of MMP9 promoter in CRC patients compared with healthy controls (mean: 47.30% and 20.31%, respectively; P > 0.001). The sensitivity and specificity of the MMP9 gene for the diagnosis of CRC were 88% and 78%, respectively. In addition, on the basis of area under the curve values, the diagnostic power of the MMP9 gene was 0.976 (P < 0.001). Moreover, our analysis established that MMP9 methylation was significantly different between the different stages of CRC (P: 0.034).
Conclusions: Our results showed that MMP9 promoter methylation in PBMCs can be used as an outstanding biomarker for CRC diagnosis. Besides, we confirmed that PBMCs are reliable sources of methylation analysis for CRC screening and MethyQESD is an accurate and fast method for quantitative methylation analyses.

Keywords: Colorectal cancer, methylation, matrix metallopeptidase 9 gene, peripheral blood mononuclear cell



How to cite this URL:
Shaygannejad A, Sohrabi B, Rad SR, Yousefisadr F, Darvish H, Soosanabadi M. Promoter methylation of matrix metallopeptidase 9 in peripheral blood mononuclear cells: A novel biomarker in a promising source for noninvasive colorectal cancer diagnosis. J Can Res Ther [Epub ahead of print] [cited 2022 Nov 29]. Available from: https://www.cancerjournal.net/preprintarticle.asp?id=344431




 > Introduction Top


Colorectal cancer (CRC) is the third common cancer and known as the second deadliest malignancy worldwide. Around 1.93 million new CRC cases with approximately 0.94 million related deaths were reported in 2020.[1],[2],[3] CRC has been described as a “silent disease,” which can be easily cured in most patients when discovered in its early stages.[4] It is of note that only about 38% of patients are diagnosed at early stages of the disease.[4],[5] This draws attention when we notice that the 5-year survival rate of patients with early and late stages of CRC is about 90% and <50%, respectively.[6],[7] Therefore, CRC screening is crucial for the early detection and treatment of CRC to reduce its high morbidity and mortality.[8] The simplest and routine procedures for CRC screening include fecal occult blood test (FOBT), flexible sigmoidoscopy and colonoscopy.[9] Despite the fact that colonoscopy is considered as a gold standard method, it is also known as an invasive procedure needing dietary restrictions, which may cause colon injury.[10],[11] Hence, some patients may avoid the procedure due to its aggressive nature, embarrassment, or reluctance to do the preparation. Flexible sigmoidoscopy and FOBT are safer diagnostic methods but confer lower sensitivity and specificity for diagnosis of CRC in early stages. Having said that, finding noninvasive, sensitive, and specific biomarkers is of paramount importance and highly needed for early CRC diagnosis.[12],[13]

Studies have emphasized that CRC results from the accumulation of both genetic and epigenetic factors over time.[14],[15] Epigenetics alterations have been shown to be involved in the pathogenesis and progression of different tumors such as CRC. Epigenetic marks and regulators, such as DNA methylation and microRNAs (miRNAs), have shown promise as clinically relevant biomarkers for CRC diagnosis.[16],[17]

DNA methylation at CpG islands located at gene promoters is generally correlated with transcriptional gene activity.[18] Aberrant promoter hypermethylation of tumor suppressor genes, which is associated with gene silencing, is fundamental for cancer initiation and progression. Studies have discovered that aberrant DNA methylation of genes is predominantly occurred in the early stages of colon cancer formation making DNA methylation biomarkers as ideal targets for the early detection of CRC.[18],[19] The evaluation of promoter hypermethylation of ctDNA (cell-free tumor DNA released into bloodstream or intestinal lumen) in different genes is highly valuable for the early diagnosis of CRC in the tumor tissue, feces, and blood.[20],[21],[22]

The blood-based screening approach is an appealing alternative because of its noninvasive nature and having high acceptance among patients. Evaluating the methylation status of circulating ctDNA is considered a promising method for early cancer diagnosis. However, there are some challenges in utilizing ctDNA as diagnostic biomarkers including high degree of ctDNA fragmentation, low blood concentration, and massive quantity of nonspecific background DNA.[23],[24]

Recently, the peripheral blood mononuclear cells (PBMCs) have been suggested as one of the novel circulating sources in several disorders, especially in inflammatory diseases and malignancies. PBMCs in bloodstream are in constant contact with various organs, and it is hypothesized that epigenetic profiling of these cells could reflect the physiological and pathological events occurring in different tissues of the body. In fact, PBMCs are able to mimic the bio-status of tissues they are in contact with including the malignant cells. This interaction between tumor cells and PBMCs is usually achieved by interchanging circulatory miRNAs, long noncoding RNAs and/or other signaling protein (e.g., cytokines), which may lead to changes in gene expression and epigenetic profile of PBMCs.[25],[26] For example, frequently-observed LINE-1 hypomethylation, in malignant cells, has been also shown in PBMCs obtained from patients with oral, nasopharyngeal, prostate, and CRCs.[27],[28] Besides, some studies have investigated the ability of promoter methylation status of specific genes in PBMCs to be used as promising biomarkers in CRC diagnosis. These genes included tissue factor pathway inhibitor2 (TFPI2), N-Myc downstream-regulated gene 4 (NDRG4), and matrix metallopeptidase 9 (MMP-9).[29],[30]

MMP-9 is shown to have tumor suppressor functions in the early stages of CRC development. However, there are also some reports of its overexpression as a necessary event for tumor invasion, metastasis, and angiogenesis.[31],[32],[33]

In the current study, we aimed to validate the ability of MMP9 promoter methylation in PBMCs for the early detection of CRC. To this end, we set out a quantitative methylation analysis using the methylation quantification endonuclease-resistant DNA (MethyQESD) method.


 > Materials and Methods Top


Study Subjects

A total of 140 participants (including 70 cases and 70 healthy controls) referred for the colonoscopy procedure were enrolled in this study. CRC cases were diagnosed by colonoscopy followed by confirming pathology report based on CRC diagnosis criteria. Seventy healthy controls, with negative colonoscopy results for CRC, and no previous family history of cancer were recruited in parallel. This study was approved by the Ethics Committee of Semnan University of Medical Sciences (approval number IR.SEMUMS.REC.1400.177) and written informed consent was filled and signed by all participants. The demographic data, as well as body mass index (BMI, calculated as weight [kg] divided by the square of height [m]) and pathological reports were obtained by using a structured questionnaire for each participant. Finally, about 2.5 ml of peripheral blood was collected into ethylenediaminetetraacetic acid anticoagulant tubes from all the study participants and stored at −20°C for further experiments.

Peripheral blood mononuclear cells isolation and DNA extraction

PBMCs were isolated via Ficoll-Hypaque-based density gradient centrifugation (Ficoll-Hypaque, Sigma) as previously described.[34] DNA was extracted from PBMCs by PrimePrep Genomic DNA Isolation Kit (GeNetBio, Korea). The yield, purity, and propriety of DNA for the quantitative methylation analysis were assessed through spectrophotometry and agarose gel electrophoresis.

Quantitative methylation analysis

Methylation analysis was performed using MethyQESD method, a combination of methylation-sensitive digestion and real-time polymerase chain reaction (PCR). This method is a combination of two consecutive processes: First, the template DNA is digested by two sets of methyl sensitive enzymes, (Methylation Quantification Digestion-MQD), and then, the resulting product is subjected to real-time PCR. Hin6I (G^CGC) does not affect methylated GCGC and was used to cut unmethylated GCGC regions. The methyl insensitive enzymes (XbaI; T^CTAGA and DraI: TTT^AAA), referred to as “Methylation-Independent Calibrator Digestion (CalD),” were separately used to digest total DNA. These enzymes were used before RT-PCR amplification and their recognition sites were not present within the amplicon. This method has been described in details by Bettstetter et al. for the first time.[35] A real-time PCR was performed in a final volume of 10 μl containing digested DNA (1 μl), 1 μl of primers and 5 μl of ×2 SYBR Green PCR Master Mix (Thermo Fisher). The forward and reverse primer sequences for the 112 bp fragment spanning the promoter sequence of MMP9 gene were GAGTCAGCACTTGCCTGTCA and CTGCCAGAGGCTCATGGTG, respectively. The cycling profile started with 5 min of initial denaturation at 95°C, and then, 40 cycles of amplification including 95°C for 20 s, 60°C for 30 s, and 72°C for 30 s were used. Finally, the percentage of methylation was calculated according to the formula: Methylation (%) = E(CtCalD-CtMQD).(E: PCR efficiency).

Statistics

The statistical analyses to evaluate the methylation status of MMP9 in case and control groups were carried out using the SPSS software version 25 (Armonk, NY, USA: IBM Corp). A receiver operating characteristic (ROC) curve analysis was used to evaluate the areas under the ROC curve area under the curve (AUC). This established the best cutoff values for the percentage of DNA methylation for diagnosing CRC after which the sensitivity and specificity were calculated accordingly. P values were calculated by independent t-test, Chi-square, or analysis of variance tests. The significance level was set at P < 0.05.


 > Results Top


In the present study, we investigated 70 CRC patients (39 males and 31 females with a mean age of 56.02 ± 11.46) and 70 healthy participants (32 males and 38 females with a mean age of 55.10 ± 9.58) as the control group. There were no substantial differences between the patients and healthy individuals in respect to the mean age (P: 0.604) and gender (P: 0.310) reflecting acceptable matching for these factors. Clearly, CRC patients and controls had no difference in term of BMI (P: 0.744).

Based on the pathological results, a 22, 26, 14, and 8 CRC patients were diagnosed with patients in the Stages I, II, III, and IV, respectively. The characteristics of the patients and healthy controls recruited in the current study are provided in [Table 1].
Table 1: Characteristics of colorectal cancer patients and healthy controls in this study

Click here to view


Matrix metallopeptidase 9 methylation analysis

Our findings demonstrated that the mean level of MMP9 promoter methylation in the CRC group was 47.30% compared to the 20.31% seen in the control group. Clearly, the average percentages of methylation between CRC patients and control individuals were statistically significant (P > 0.001) [Figure 1] and [Table 2]. The appropriate cutoff point for MMP9 promoter methylation level to distinguish between CRC cases and healthy controls was set at ≤30%. Therefore, the sensitivity and specificity was calculated as 88% and 78%, respectively. In addition, the diagnostic power of the MMP9 gene was 0.976 (P < 0.001) on the basis of AUC values [Figure 2].
Figure 1: Comparison of matrix metallopeptidase 9 promoter methylation level between patients with colorectal cancer (47.30%) and healthy controls (20.31%), P < 0.001. HCs: Healthy controls; CRC: Colorectal cancer

Click here to view
Figure 2: The receiver operating characteristic curves of matrix metallopeptidase 9 promoter methylation level in patients with colorectal cancer compared with healthy controls. Area under the curve: 0.976; P < 0.001

Click here to view
Table 2: The percentages of methylation in case and control groups and their diagnostic value

Click here to view


The average percentages of MMP9 promoter methylation were also found to be statistically significant (P: 0.034) for patients in different stages of the disease as follows: 41.82%, 44.92%, 56.60%, and 53.82% for patients in Stages I, II, III, and IV of the disease, respectively [Table 2].


 > Discussion Top


Considering the invasive nature of colonoscopy and the low sensitivity and specificity of other screening methods such as FOBT and fecal immunochemical test, identifying novel powerful biomarkers for early CRC diagnosis has become a hot research topic worldwide. As aberrations in methylation of specific genes are commonly occurred in multistep carcinogenesis and this phenomenon plays a causative role in CRC development and progression, finding appropriate DNA methylation biomarkers for early diagnosis of is conceivable and of high value.[36],[37] Multiple blood-based DNA methylation biomarkers have been reported thus far for early CRC diagnosis.[36],[38] However, there are some limitations for using ctDNA methylation patterns as diagnostic biomarkers including fragmentation and low concentration of circulating tumor-specific methylated DNA in the excess of unmethylated “normal” cell-free DNA.[24],[39] Moreover, most studies use bisulfite treatment for the analysis of methylation pattern which leads to degradation of ctDNA.[40]

It has been revealed that tumor-specific methylation patterns can also be identified in PBMCs and are reliable sources of methylation analysis for CRC screening.[25] For instance, PBMCs from colorectal and nasopharyngeal cancer patients were found to have obviously lower levels of overall LINE-1 methylation compared to samples obtained from normal participants.[27] Gene-specific methylation analysis indicated that TFPI2, NDRG4, and especially MMP9 are highly potent biomarkers for CRC diagnosis.[29],[30] In these studies, reported that these genes are hypermethylated in PBMCs from CRC patients compared with healthy controls and proposed them as a powerful biomarker in the detection of CRC.

In the current study, we investigated the ability of MMP9 promoter methylation to be used as a diagnostic biomarker in a larger sample size than previous studies and using a different method for quantitative methylation analysis (MethyQESD method). The AUC values for ROC curve analysis for MMP9 promoter methylation in PBMCs were 0.976 in our study, making it as an outstanding biomarker for distinguishing between patients and healthy individuals.

Some studies have indicated the oncogenic functions for MMP9 with its upregulation associated with CRC progression and poor prognosis.[32],[41],[42] However, the tumor suppressor functions in CRC development have been also reported for this gene. For instance, Garg et al. demonstrated that MMP9 holds protective roles and acts as a tumor suppressor in colitis-associated colon cancer (CAC) through regulation of notch activation.[31] It was also discovered that MMP9 expression is correlated with reduced reactive oxygen species (ROS) level and increased expression of mismatch repair genes, which in turn leads to less DNA damage in CAC.[43] On the other hand, it has been confirmed that MMP9 expression is regulated with promoter methylation.[44] Besides, Kuhmann et al. reported for the first time that MMP9 is hypermethylated in CRC tissues.[33]

Boonsongserm et al. co-cultured PBMCs from normal participants with CRC cell line and verified that CRC cells could lead to hypermethylation of MMP9 in PBMCs.[30] These findings implicate that the evaluation of MMP9 promoter methylation in PBMCs is capable of being used as a promising marker in early diagnosis of CRC.

Our study also revealed statistically significant average percentages of methylation in different stages of the disease, reflecting the diagnostic value of this biomarker even in determining the stage of disease in affected patients. Moreover, the average methylation level in stage IV is found to be lower than stage III, which may be indicative of this fact that overexpression of MMP9 is necessary for tumor invasion and metastasis.[45] However, this hypothesis needs to be further investigated in studies with larger sample sizes.


 > Conclusions Top


In conclusion, considering the acceptable sensitivity and specificity of this marker, we confirmed that MMP9 promoter methylation status in PBMCs is a novel promising biomarker and holds high power and accuracy in distinguishing CRC patients from healthy participants in the early stages of the disease. There are probably some limitations in the current study in terms of statistical validity of our results due to its small sample size and number of genes investigated. Therefore, further similar studies with larger sample sizes and multiple genes involved are necessary to confirm the suggested findings.

Acknowledgments

We would like to appreciate any support provided by Semnan University of Medical Sciences.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Siegel RL, Miller KD, Goding Sauer A, Fedewa SA, Butterly LF, Anderson JC, et al. Colorectal cancer statistics, 2020. CA Cancer J Clin 2020;70:145-64.  Back to cited text no. 1
    
2.
Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2021;71:209-49.  Back to cited text no. 2
    
3.
Xi Y, Xu P. Global colorectal cancer burden in 2020 and projections to 2040. Transl Oncol 2021;14:101174.  Back to cited text no. 3
    
4.
Vatandoost N, Ghanbari J, Mojaver M, Avan A, Ghayour-Mobarhan M, Nedaeinia R, et al. Early detection of colorectal cancer: From conventional methods to novel biomarkers. J Cancer Res Clin Oncol 2016;142:341-51.  Back to cited text no. 4
    
5.
Siminoff LA, Rogers HL, Harris-Haywood S. Missed opportunities for the diagnosis of colorectal cancer. BioMed Res Int 2015;2015:285096.  Back to cited text no. 5
    
6.
Maajani K, Khodadost M, Fattahi A, Shahrestanaki E, Pirouzi A, Khalili F, et al. Survival rate of colorectal cancer in Iran: A systematic review and meta-analysis. Asian Pac J Cancer Prev 2019;20:13-21.  Back to cited text no. 6
    
7.
Favoriti P, Carbone G, Greco M, Pirozzi F, Pirozzi RE, Corcione F. Worldwide burden of colorectal cancer: A review. Updates Surg 2016;68:7-11.  Back to cited text no. 7
    
8.
Nikolouzakis TK, Vassilopoulou L, Fragkiadaki P, Mariolis Sapsakos T, Papadakis GZ, Spandidos DA, et al. Improving diagnosis, prognosis and prediction by using biomarkers in CRC patients (Review). Oncol Rep 2018;39:2455-72.  Back to cited text no. 8
    
9.
Niederreiter M, Niederreiter L, Schmiderer A, Tilg H, Djanani A. Colorectal cancer screening and prevention – Pros and cons. Memo Mag Eur Med Oncol 2019;12:239-43.  Back to cited text no. 9
    
10.
Zhang K, Yuan Q, Zhu S, Xu D, An Z. Is unsedated colonoscopy gaining ground over sedated colonoscopy? J Natl Med Assoc 2018;110:143-8.  Back to cited text no. 10
    
11.
Issa IA, Noureddine M. Colorectal cancer screening: An updated review of the available options. World J Gastroenterol 2017;23:5086-96.  Back to cited text no. 11
    
12.
Martins BA, De Bulhões GF, Cavalcanti IN, Martins MM, de Oliveira PG, Martins AM. Biomarkers in colorectal cancer: The role of translational proteomics research. Front Oncol 2019;9:1284.  Back to cited text no. 12
    
13.
Tepus M, Yau TO. Non-invasive colorectal cancer screening: An overview. Gastrointest Tumors 2020;7:62-73.  Back to cited text no. 13
    
14.
Bardhan K, Liu K. Epigenetics and colorectal cancer pathogenesis. Cancers (Basel) 2013;5:676-713.  Back to cited text no. 14
    
15.
Mosallaei M, Simonian M, Salehi R. Microsatellite instability in colorectal cancer from causes to detection. J Cancer Res Ther 2021;17:292.  Back to cited text no. 15
    
16.
Jung G, Hernández-Illán E, Moreira L, Balaguer F, Goel A. Epigenetics of colorectal cancer: Biomarker and therapeutic potential. Nat Rev Gastroenterol Hepatol 2020;17:111-30.  Back to cited text no. 16
    
17.
Karimzadeh MR, Pourdavoud P, Ehtesham N, Qadbeigi M, Asl MM, Alani B, et al. Regulation of DNA methylation machinery by epi-miRNAs in human cancer: Emerging new targets in cancer therapy. Cancer Gene Ther 2021;28:157-74.  Back to cited text no. 17
    
18.
Deaton AM, Bird A. CpG islands and the regulation of transcription. Genes Dev 2011;25:1010-22.  Back to cited text no. 18
    
19.
Lao VV, Grady WM. Epigenetics and colorectal cancer. Nat Rev Gastroenterol Hepatol 2011;8:686-700.  Back to cited text no. 19
    
20.
Ng JM, Yu J. Promoter hypermethylation of tumour suppressor genes as potential biomarkers in colorectal cancer. Int J Mol Sci 2015;16:2472-96.  Back to cited text no. 20
    
21.
Kong C, Fu T. Value of methylation markers in colorectal cancer (Review). Oncol Rep 2021;46:177.  Back to cited text no. 21
    
22.
Anghel SA, Ioniţă-Mîndrican CB, Luca I, Pop AL. Promising epigenetic biomarkers for the early detection of colorectal cancer: A systematic review. Cancers (Basel) 2021;13:4965.  Back to cited text no. 22
    
23.
Norton SE, Luna KK, Lechner JM, Qin J, Fernando MR. A new blood collection device minimizes cellular DNA release during sample storage and shipping when compared to a standard device. J Clin Lab Anal 2013;27:305-11.  Back to cited text no. 23
    
24.
Sumbal S, Javed A, Afroze B, Zulfiqar HF, Javed F, Noreen S, et al. Circulating tumor DNA in blood: Future genomic biomarkers for cancer detection. Exp Hematol 2018;65:17-28.  Back to cited text no. 24
    
25.
Mosallaei M, Ehtesham N, Rahimirad S, Saghi M, Vatandoost N, Khosravi S. PBMCs: A new source of diagnostic and prognostic biomarkers. Arch Physiol Biochem 2020;15:1-7.  Back to cited text no. 25
    
26.
Frampton AE, Fletcher CE, Gall TM, Castellano L, Bevan CL, Stebbing J, et al. Circulating peripheral blood mononuclear cells exhibit altered miRNA expression patterns in pancreatic cancer. Expert Rev Mol Diagn 2013;13:425-30.  Back to cited text no. 26
    
27.
Kitkumthorn N, Tuangsintanakul T, Rattanatanyong P, Tiwawech D, Mutirangura A. LINE-1 methylation in the peripheral blood mononuclear cells of cancer patients. Clin Chim Acta 2012;413:869-74.  Back to cited text no. 27
    
28.
Han Y, Xu J, Kim J, Wu X, Gu J. LINE-1 methylation in peripheral blood leukocytes and clinical characteristics and prognosis of prostate cancer patients. Oncotarget 2017;8:94020-7.  Back to cited text no. 28
    
29.
Bagheri H, Mosallaei M, Bagherpour B, Khosravi S, Salehi AR, Salehi R. TFPI2 and NDRG4 gene promoter methylation analysis in peripheral blood mononuclear cells are novel epigenetic noninvasive biomarkers for colorectal cancer diagnosis. J Gene Med 2020;22:e3189.  Back to cited text no. 29
    
30.
Boonsongserm P, Angsuwatcharakon P, Puttipanyalears C, Aporntewan C, Kongruttanachok N, Aksornkitti V, et al. Tumor-induced DNA methylation in the white blood cells of patients with colorectal cancer. Oncol Lett 2019;18:3039-48.  Back to cited text no. 30
    
31.
Garg P, Sarma D, Jeppsson S, Patel NR, Gewirtz AT, Merlin D, et al. Matrix metalloproteinase-9 functions as a tumor suppressor in colitis-associated cancer. Cancer Res 2010;70:792-801.  Back to cited text no. 31
    
32.
Yang B, Tang F, Zhang B, Zhao Y, Feng J, Rao Z. Matrix metalloproteinase-9 overexpression is closely related to poor prognosis in patients with colon cancer. World J Surg Oncol 2014;12:24.  Back to cited text no. 32
    
33.
Kuhmann C, Li C, Kloor M, Salou M, Weigel C, Schmidt CR, et al. Altered regulation of DNA ligase IV activity by aberrant promoter DNA methylation and gene amplification in colorectal cancer. Hum Mol Genet 2014;23:2043-54.  Back to cited text no. 33
    
34.
Fuss IJ, Kanof ME, Smith PD, Zola H. Isolation of whole mononuclear cells from peripheral blood and cord blood. Curr. Protoc. Immunol. 2009;85:7.1.1-7.1.8.  Back to cited text no. 34
    
35.
Bettstetter M, Dechant S, Ruemmele P, Vogel C, Kurz K, Morak M, et al. MethyQESD, a robust and fast method for quantitative methylation analyses in HNPCC diagnostics using formalin-fixed and paraffin-embedded tissue samples. Lab Invest 2008;88:1367-75.  Back to cited text no. 35
    
36.
Dong L, Ren H. Blood-based DNA methylation biomarkers for early detection of colorectal cancer. J Proteomics Bioinform 2018;11:120-6.  Back to cited text no. 36
    
37.
Bariol C, Suter C, Cheong K, Ku SL, Meagher A, Hawkins N, et al. The relationship between hypomethylation and CpG island methylation in colorectal neoplasia. Am J Pathol 2003;162:1361-71.  Back to cited text no. 37
    
38.
Jensen SØ, Øgaard N, Ørntoft MB, Rasmussen MH, Bramsen JB, Kristensen H, et al. Novel DNA methylation biomarkers show high sensitivity and specificity for blood-based detection of colorectal cancer – A clinical biomarker discovery and validation study. Clin Epigenetics 2019;11:1-14.  Back to cited text no. 38
    
39.
Tanić M, Beck S. Epigenome-wide association studies for cancer biomarker discovery in circulating cell-free DNA: Technical advances and challenges. Curr Opin Genet Dev 2017;42:48-55.  Back to cited text no. 39
    
40.
Tanaka K, Okamoto A. Degradation of DNA by bisulfite treatment. Bioorg Med Chem Lett 2007;17:1912-5.  Back to cited text no. 40
    
41.
Said AH, Raufman JP, Xie G. The role of matrix metalloproteinases in colorectal cancer. Cancers (Basel) 2014;6:366-75.  Back to cited text no. 41
    
42.
Otero-Estévez O, Chiara LD, Rodríguez-Girondo M, Rodríguez-Berrocal FJ, Cubiella J, Castro I, et al. Serum matrix metalloproteinase-9 in colorectal cancer family-risk population screening. Sci Rep 2015;5:13030.  Back to cited text no. 42
    
43.
Walter L, Canup B, Pujada A, Bui TA, Arbasi B, Laroui H, et al. Matrix metalloproteinase 9 (MMP9) limits reactive oxygen species (ROS) accumulation and DNA damage in colitis-associated cancer. Cell Death Dis 2020;11:767.  Back to cited text no. 43
    
44.
Chicoine E, Estève PO, Robledo O, Van Themsche C, Potworowski EF, St-Pierre Y. Evidence for the role of promoter methylation in the regulation of MMP-9 gene expression. Biochem Biophys Res Commun 2002;297:765-72.  Back to cited text no. 44
    
45.
Tutton MG, George ML, Eccles SA, Burton S, Swift RI, Abulafi AM. Use of plasma MMP-2 and MMP-9 levels as a surrogate for tumour expression in colorectal cancer patients. Int J Cancer 2003;107:541-50.  Back to cited text no. 45
    


    Figures

  [Figure 1], [Figure 2]
 
 
    Tables

  [Table 1], [Table 2]



 

 
Top
 
 
  Search
 
     Search Pubmed for
 
    -  Shaygannejad A
    -  Sohrabi B
    -  Rad SR
    -  Yousefisadr F
    -  Darvish H
    -  Soosanabadi M
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Conclusions>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed671    
    PDF Downloaded31    

Recommend this journal