Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 
ORIGINAL ARTICLE
Ahead of print publication  

Role of indole curcumin in the epigenetic activation of apoptosis and cell cycle regulating genes


 Department of Biochemistry and Molecular Biology, School of Life Sciences, Pondicherry University, Puducherry, India

Date of Submission01-Jun-2021
Date of Acceptance13-May-2021
Date of Web Publication25-Apr-2022

Correspondence Address:
Rukkumani Rajagopalan,
Department of Biochemistry and Molecular Biology, School of Life Sciences, Pondicherry University, Puducherry - 605 014
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/jcrt.jcrt_28_21

 > Abstract 


Background: Head-and-neck squamous cell carcinoma is associated with the epigenetic silencing of various genes such as DAPK, ataxia telangiectasia mutated (ATM), BRCA1, p16INK4a, pVHL, p16, and RASSF1A. The most common epigenetic change observed in these genes is DNA methylation that directs the studies toward finding inhibitors for DNA methyltransferases (DNMTs), the protagonist in the action. The present study focuses on analyzing the possibility whether indole curcumin can reverse epigenetic changes of the various tumor suppressor genes, characteristically silenced by methylation, by inhibiting the major methylation enzyme DNA methyltransferase 1 or DNMT1.
Materials and Methods: The cytotoxic effects of indole curcumin were studied through the MTT and lactate dehydrogenase assays. To determine the apoptosis-mediated death of HEp-2 cells, fluorescence imaging using different stains was done. Gene or mRNA expression analysis was done for p53, ATM, and DAPK genes.
Results: The results obtained from this study clearly indicate that the indole analog of curcumin plays a remarkable role in activating genes involved in cell cycle regulation and apoptosis induction through epigenetic regulation. The influence that the drug has on the methylation status of gene promoter sequence of the ATM gene is also very significant.
Conclusion: Indole curcumin, being an analog of curcumin, promises to be a very useful drug molecule having various potential targets. The target selected for this study was DNMT1 enzyme and the drug seems to actually show the effects; it was predicted to be having on the target molecule.

Keywords: Ataxia telangiectasia mutated, DNA methyltransferase, epigenetics, indole curcumin analog, tumor suppressor genes



How to cite this URL:
Chandramohan S, Chatterjee O, Pajaniradje S, Subramanian S, Bhat SA, Rajagopalan R. Role of indole curcumin in the epigenetic activation of apoptosis and cell cycle regulating genes. J Can Res Ther [Epub ahead of print] [cited 2022 Nov 29]. Available from: https://www.cancerjournal.net/preprintarticle.asp?id=343917




 > Introduction Top


Head-and-neck squamous cell carcinoma (HNSCC) is a significant public health concern. It is one of the most common human cancers that have a high morbidity, mortality, and very few treatment options other than standard surgery, cytotoxic chemotherapy, and radiation therapy available at present.[1] There is a need for a better and safer treatment option. Studies are underway to discover novel natural principles and to develop their analogs which would be able to target and effectively treat the disease.

Like many other cancers, HNSCC has its own epigenome which has the information of all the genes that have been epigenetically modified to contribute toward its development.[2] Genes that have tumor suppressor functions, those that participate in cell cycle checkpoints, and those which induce DNA damage repair and apoptosis are the ones which on epigenetic modification lead to cancer development.[3] HNSCC is associated with the epigenetic silencing of the following genes: DAPK, ataxia telangiectasia mutated (ATM), BRCA1, p16INK4a, pVHL, p16, RASSF1A, etc. The most common epigenetic change observed in these genes is DNA methylation thus directing the studies toward finding inhibitors for DNA methyltransferases (DNMTs), the protagonist in the action.[4] To study the HNSCC cell characteristics and to probe into possibilities for curing it, in vitro experiments were performed on the HEp-2 cell line.

Previous reports on the genome analysis of HNSCC have thrown much light on the molecular pathogenesis of the disease. It has been found to progress through the involvement of several dysregulated biological pathways.[5] Many genes of the HEp-2 genome have been extensively studied for their expression patterns including the genes involved in cell cycle control and the genes involved in the various apoptosis triggering pathways. Genes such as p53, ATM, DAPK, p16 are inactivated in HNSCC due to hypermethylation.[6],[7] Aberrant methylation in the promoter region of tumor suppressor genes (TSGs) will have an impact on the major molecular mechanisms, including apoptosis, cell cycle arrest, DNA damage response, tumor invasion, and metastasis.[8] In the light of this, several attempts are being carried out to identify lead compounds which can restore the TSGs that can successfully curb cancer cell proliferation and survival.[9]

Hence, in this study, we aimed to modify or activate the gene expression profiles of such genes which can help to bring back the cell to its original state. The compound that was chosen to accomplish this task is an indole analog of curcumin. Curcumin is a natural principle obtained from Curcuma longa and is a very potent anticancerous drug. It has been established from earlier studies that curcumin can act as an inhibitor for DNMT1 which is one of the most active enzymes that modulate the methylation status of the promoter regions of multiple genes thus controlling their expression levels.[10],[11] Studies have proven that in many cancer cell lines, including the HNSCC cell lines, the expression of genes which have important roles in cell cycle regulation and apoptosis induction are epigenetically silenced through methylation.[12] Thus, if the methylation status of such genes, crucial for the maintenance of cells in a normal condition, could be reversed, it would definitely be a huge step forward in treating the disease.

Curcumin has been studied and found to have an inhibitory effect on DNMT1 activity. Addition of an indole group on the curcumin structure increases its solubility and hence makes it more biologically available in the body when compared to the parent curcumin molecule. This increases the possibility of the drug to reach its correct target and execute its effects. The postulated effect of the drug used for this study is that, like curcumin, its analog also acts as a DNMT1 inhibitor and because of its increased bioavailability would be more proficient in executing its effect.


 > Materials and Methods Top


Human HNSCC cell line HEp-2 was obtained from NCCS, Pune. The cells were maintained and grown on filtered Dulbecco's Modified Eagle Medium (HiMedia) containing 10% fetal bovine serum (HiMedia). Other analytical grade laboratory chemicals and cell culture grade flasks, petri dishes, and multiple well plates were used. Indole analog of curcumin (molecule weight: 354.4) was synthesized in the department of chemistry of our university. It was prepared as a stock of 100 mM in DMSO and used in all the experiments. 37°C incubator supplied with 5% CO2 was used to maintain the culture environment.

Cytotoxicity assay

MTT assay

In vitro cytotoxicity of HEp-2 cells was assayed using the MTT as described by Mosmann.[13] The HEp-2 cells at 80%–90% confluence were trypsin digested and re-seeded on a 96-well cell culture plate (Falcon, BD Biosciences, USA); the cells were incubated at 37°C in 5% CO2 atmosphere. After 24 h, the culture media was changed with plain DMEM supplemented with various concentrations of the indole analog of curcumin (2–38 μM), plain DMEM medium was employed as a control treatment. Following 48 h of incubation, the media was removed and 20 μl of 5 mg/ml MTT solution was added into each well and incubated for 4 h at 37°C. The supernatants were then removed; 100 μl of DMSO was added to each well; and the violet-colored formazan crystals were dissolved. The absorbance was read at 570 nm in a VersaMax ELISA Microplate Reader, Molecular Devices Inc., Sunnyvale, CA, USA, and the IC50 values were calculated.[14]

Lactate dehydrogenase assay

Lactate dehydrogenase (LDH) assay was performed as described by Horrocks et al.[15] Cells were incubated with the different concentrations of drug for 48 h. To each 0.1 ml of conditioned media, 1 mL of buffered substrate (lithium lactate in 0.1 M glycine buffer, pH 10), 0.2 mL of water was added and incubated at 37°C. 0.2 mL of NAD+ solution was added to this and incubated at 37°C for 15 min. Following this, 1 mL of DNPH reagent was added and incubated again for 15 min. Finally, 10 mL of sodium hydroxide (0.4 N) was added and the absorbance was read at 440 nm using an ultraviolet (UV)-visible spectrophotometer (Shimadzu UV-1700).[16] The LDH concentration was then calculated using these time-dependent absorbance values.

Protein extraction and estimation

Cells were washed in ice-cold phosphate buffer saline (PBS) and incubated in ice-cold RIPA lysis buffer for 30 min with repeated vortexing in 20 min intervals for about 3 times. Protein concentration was estimated using Lowry's method.

Acridine orange/ethidium bromide staining

Acridine orange/ethidium bromide (AO/EB) staining was carried out to detect morphological evidence of apoptosis. HEp-2 cells were treated with IC50 of indole curcumin for 48 h, washed with PBS, and trypsinized. 25 μl of cell suspension (1 × 104 cells/ml) was mixed with 1 μl of AO/EB solution (one part each of 10 μg/ml of acridine orange and 0.35 μg/ml of ethidium bromide in PBS) just before microscopy. Ten microliters of gently mixed suspension were placed on a microscope slide covered with glass slip and examined under the blue filter of an inverted fluorescent microscope (Olympus 1 × 71) connected to a digital imaging system and the images were documented.

Hoechst 33342 staining

Cell nuclear morphology was evaluated by fluorescence microscopy following Hoechst 33342 DNA staining. The cells were treated with IC50 concentration of the drug and incubated for 48 h. The cells were permeabilized and fixed with 4% paraformaldehyde in 1% Triton X-100, followed by incubation at RT for 15 min, removal of paraformaldehyde and two times wash with 1 × PBS. 70% ethanol was added to all the wells and incubated at 4°C for 4 h. After the incubation, the cells were again washed using 1 × PBS solution and 8 μg/mL. Hoechst 33342 was added followed by 30 min incubation at 37°C in the dark. The cells were then examined under an inverted fluorescent microscope (Olympus 1 × 71) connected to a digital imaging system.

Cell cycle analysis

Cells treated with varying concentrations of the drug were incubated for 48 h and fixed with absolute ethanol and then stored at 4°C overnight. After the incubation, the cells were washed with 1 × PBS followed by resuspension of the cells into 100 μl of flow cytometry staining solution containing 25 μg/ml propidium iodide (PI); 0.1% triton × (as a permeabilizing agent); 50 μg/ml RNase in PBS pH 7.2. The cells were incubated in the dark for a minute and then were analyzed by the FACS instrument (Guava easyCyte 8HT Flow Cytometer).

RNA extraction and reverse transcriptase polymerase chain reaction

Total RNA was extracted from the treated cells using TRI/TRIZOL reagent. The primer sequences for ATM gene used were:

Forward: 5'-ATAGATTGTGTAGGTTCCGATGG 3'and

Reverse: 5' CATCTTGTCTCAGGTCATCACG 3'.[17]

The primer sequences used for DAPK were:

Forward: 5' GCC TGG AGA CGG AGA AGA T 3' and

Reverse: 5' AAG TCC CGT GGC TGG TAG A 3'.[18]

DNA extraction and bisulfite treatment

Genomic DNA was isolated from HEp-2 cells, treated with bisulfite,[19] then amplified through polymerase chain reaction (PCR).

Methylation-specific polymerase chain reaction

Following the bisulfite modification, two PCR reactions were set up. The primer sequences used to detect the methylated promoter sequence were as follows:

Forward: 5'-GGAGTTCGAGTCGAAGGGC-3' and

Reverse: 5'-CTACCTACTCCCGCTTCCGA-3'.

The primers used to amplify the unmethylated promoter region were:

Forward: 5'-GGAGTTCGAGTCGAAGGGC-3' and

Reverse: 5'-CTACCTACTCCCGCTTCCGA-3'.[20] The PCR amplified product was then run in an 8% acrylamide gel and visualized using the gel documentation system (Syngene Bio Imaging Gel Doc) after staining with 0.001% ethidium bromide solution.[21]

DNA polyacrylamide gel electrophoresis

To prepare a 8% gel, the buffers and solutions were mixed in the following proportions, 3.2 ml 30% acrylamide, 6.4 ml water, 2.4 ml 5 × TBE, 200 μl 10% APS, and 10 μl TEMED. The acrylamide was allowed to polymerize for 30–60 min at room temperature. Once the samples were ready, they were loaded onto the gel and run using 1 × TBE buffer as the running buffer. After the run was complete, the gel was stained using 0.001% ethidium bromide solution and then visualized through the gel documentation system (Syngene Bio Imaging Gel Doc).

Molecular docking

Ligand preparation

The ligand structure was drawn and saved in Mol2 format using the Marvin Sketch tool of ChemAxon Ltd. (http://www.chemaxon.com/marvin/).

Protein preparation

The protein structures were prepared using protein preparation wizard of Schrodinger v9.2.

Docking

Glide module of Schrödinger was used for docking studies of the ligand.

Binding free energies calculations

Binding free energies were calculated using the molecular mechanics/generalized born surface area in the PRIME module of Schrodinger, Schrödinger LLC, New York, NY.[22]

Statistical analysis

All the data were analyzed using the GraphPad Software, San Diego California USA. For all the measurements, one-way ANOVA followed by Tukey's test was used to assess the statistical significance between groups. A statistically significant difference was considered at the level of P ≤ 0.05.


 > Results Top


Cytotoxic effects of indole curcumin

The cytotoxic effects of indole curcumin were studied through the MTT and LDH assays. For MTT assay, the HEp-2 cells were treated with increasing dosage concentration of indole curcumin and checked for the cell viability after 48 h of incubation with the drug. The IC50 value for indole curcumin was deduced from the dose-dependent cell viability graph. The cell viability decreased with increase in concentration [Figure 1]a and the IC50 was found to be 24 μg/ml.

LDH assay was performed by treating the HEp-2 cells with increasing dosage concentration of indole curcumin. For this study, LDH released into the media was used as the sample. The dead or apoptotic cells would release more of LDH than normal live ones. The media taken from a plate treated with higher dosage concentration of the drug showed higher LDH activity [Figure 1]b. This shows that at higher concentrations indole curcumin shows higher cytotoxic activity.
Figure 1: Cytotoxic effect of indole curcumin by MTT and LDH assays. (a) MTT assay shows growth inhibition of HEp-2 cancer cells (b) LDH assay shows the effect of different concentrations of indole curcumin on LDH release of HEp-2 cancer cells. Values are expressed in mean ± SD of three independent experiments. ANOVA followed by Tukey's test was used to assess the statistical significance between the groups. *P ≤ 0.05 level, significance related to control group. LDH = Lactate dehydrogenase, SD = Standard deviation

Click here to view


Observation of cytomorphology

Indole curcumin-treated HEp-2 cells after an incubation of 48 h displayed cytomorphological alterations like changed cell structure [Figure 2]b whereas control cells showed no such alterations [Figure 2]a.
Figure 2: Morphological analysis of HEp-2 cells (a) Control cells, (b) Cells treated with IC50 concentration of indole curcumin

Click here to view


Acridine orange/ethidium bromide staining

Control and indole curcumin-treated HEp-2 cells incubated for 48 h were used for fluorescent imaging after staining with AcOr/EtBr. The images were taken using Olympus 1 × 71 fluorescent microscope. In this study, indole curcumin-treated HEp-2 cells showed morphologically differing apoptotic cells which have taken up the EtBr stain and appear round and orange [Figure 3]b unlike the normal cells that appear green [Figure 3]a.
Figure 3: Detection of apoptosis using AO/EB stain (a) Control cells, (b) Indole curcumin-treated cells. Live cells stain green, yellow – the early apoptotic and orange – the late apoptotic stages were examined by AO/EB staining. AO/EB = Acridine orange/ethidium bromide

Click here to view


Hoechst 33342 staining

Control and indole curcumin-treated HEp-2 cells were incubated for 48 h. Fluorescent imaging was done after staining with Hoechst 33342. The control cells showed no nuclear fragmentation [Figure 4]a, whereas the indole curcumin-treated cells showed fragmented nuclei [Figure 4]b in which apoptosis has been triggered by the action of the drug.
Figure 4: Effect on nuclear morphology of HEp-2 cells using Hoechst 33342 stain (a) Control cells, (b) Indole curcumin-treated cells. Condensed or fragmented nuclei were observed in the treated cell

Click here to view


Cell cycle analysis

The percentage of cells in each phase of the cell cycle was calculated for control and indole curcumin-treated cells incubated for 48 h. The counting was done using a fluorescence-activated cell sorting or FACS instrument after staining the cells with PI. Cell cycle arrest was seen in the G1 phase for the treated cells in comparison with the control cells [Figure 5].
Figure 5: Effect of indole curcumin on cell cycle distribution of Hep-2 cells by flow cytometry. Values are expressed in mean ± SD of three independent experiments. *P ≤ 0.05 level, significance related to control group. SD = Standard deviation

Click here to view


Gene expression studies

Gene or mRNA expression analysis was done for p53, ATM, and DAPK genes. These genes play an important role in cell cycle regulation and apoptosis induction. These studies were performed using the total RNA extracted from control and treated cells incubated for 48 h. The RNA extracted was converted into cDNA and then PCR amplified using appropriate gene-specific primers.

p53 mRNA expression

β actin being a housekeeping gene was used as a reference standard [Figure 6]a. Based on comparison with the β actin gene expression (using software ImageJ, Bethesda, Maryland, USA), it was found that on treatment with indole curcumin, the p53 gene expression significantly increased [Figure 6]b.
Figure 6: Reverse transcriptase PCR for the gene expression of p53 from Hep2 cancer cells in the presence or absence of indole curcumin (a) Gene expression of p53. Beta actin served as internal control. (b) Densitometry graph comparing the mRNA levels in control and treated cell. Values are expressed in mean ± SD of three independent experiments. *P ≤ 0.05 level, significance related to control group. PCR = Polymerase chain reaction, SD = Standard deviation

Click here to view


Ataxia telangiectasia mutated mRNA expression

To quantify the ATM expression levels, the bands were compared with the β actin expression levels in samples treated with the same increasing concentration of indole curcumin [Figure 7]a. A graphical comparison between β actin and ATM shows the increase in expression levels of ATM on indole curcumin-treated cells in a dose-dependent manner [Figure 7]b.
Figure 7: Reverse transcriptase PCR for the gene expression of ATM from Hep2 cancer cells in the presence or absence of indole curcumin (a) Gene expression of ATM. Beta actin served as internal control, (b) Densitometry graph comparing the mRNA levels in control and treated cell. Values are expressed in mean ± SD of three independent experiments. *P ≤ 0.05 level, significance related to control group. PCR = Polymerase chain reaction, SD = Standard deviation, ATM = Ataxia telangiectasia mutated

Click here to view


DAPK mRNA expression

The DAPK expression was also quantified through comparison to β actin expression levels of the same samples treated with the same dosages [Figure 8]a. The graphical representation of the changes in DAPK gene expression with β actin expression as a reference standard is given in [Figure 8]b. It is clear from this graph that the drug does not have a significant effect on the DAPK expression at the mRNA level.
Figure 8: Reverse transcriptase PCR for the gene expression of DAPK from Hep2 cancer cells in the presence or absence of indole curcumin (a) Gene expression of DAPK. Beta actin served as internal control, (b) Densitometry graph comparing the mRNA levels in control and treated cell. Values are expressed in mean ± SD of three independent experiments. PCR = Polymerase chain reaction, SD = Standard deviation, ATM = Ataxia telangiectasia mutated

Click here to view


Methylation-specific polymerase chain reaction analysis

The methylation status analysis was done for the promoter region of the ATM gene. The DNA was first bisulfite converted and then PCR amplified using methylation-specific primers (mATM) for the promoter region of the gene and then run on an 8% polyacrylamide gel for visualization. The PCR products amplified using primers specific for methylated promoter sequence of ATM in bisulfite-treated DNA [Figure 9]a were compared to the PCR products amplified using primers specific for nonmethylated promoter region of ATM [Figure 9]b. The PCR amplifications were performed using bisulfite-treated DNA extracted from HEp-2 control and indole curcumin-treated cells (incubated for 48 h). The comparative analysis of the methylation status of the promoter region of ATM was done. The comparison determines whether the gene is epigenetically modulated by the action of indole curcumin or not. [Figure 9]c clearly shows that on treatment with indole curcumin, the methylation levels of the promoter region of the ATM gene drastically go down.
Figure 9: Methylation-specific PCR (a) Expression of mATM in bisulfite converted DNA when amplified using methylation-specific primers, (b) Expression of mATM in bisulfite-treated DNA amplified using primers specific for unmethylated promoter region of ATM, (c) Densitometry graph comparing the methylation status of the promoter region of ATM in control and amp; treated. Values are expressed in mean ± SD of three independent experiments. *P ≤ 0.05 level, significance related to control. PCR = Polymerase chain reaction, ATM = Ataxia telangiectasia mutated, SD = Standard deviation

Click here to view


Molecular docking of curcumin analog with DNA methyltransferase 1

The curcumin analog was docked into the MTase domain of DNMT1. The co-crystallized ligand sinefungin was shown to form hydrogen bonds with L1151, E1168, M1169, C1191, E1266, N1578, and V1580. The curcumin analog formed two hydrogen bonds, one between the hydroxyl group (-OH) of ligand and carbonyl oxygen (-C = O) of Glu 1168 and the other between -NH group of ligand and carbonyl oxygen (-C = O) of Glu 1266. Moreover, a π-π stacking interaction with Phe1145 was also formed. The glide dock score for curcumin analog was (−6.848). The data are illustrated in [Figure 10] and also in [Table 1].
Figure 10: Dock pose of curcumin analog (carbon atoms in orange) with DNMT1 (PDB: 3SWR). Two hydrogen bonds are formed between the hydroxyl group (-OH) of ligand with carbonyl oxygen (-C = O) of Glu 1168 and -NH group of ligand with carbonyl oxygen (-C = O) of Glu 1266. Glide score: −6.848; ΔG: −64.317. DNMT1 = DNA methyltransferase 1

Click here to view
Table 1: Describing the comparative docking scores and the binding energies of the two forms of indole analogue of curcumin and that of standard co-crystallised ligand for the specific site on the Dnmt1 molecule which is under investigation

Click here to view



 > Discussion Top


Curcumin (a polyphenolic compound in turmeric) is well known for its anti-inflammatory, antioxidant, and anticancer properties. It also acts as a potent epigenetic modulator.[23] The role played by curcumin in facilitating its epigenetic regulatory mechanisms includes the inhibition of DNMTs, regulation of histone modifications through the modulation of histone acetyltransferases and histone deacetylases, regulation of microRNAs, action as a DNA binding agent, and interaction with transcription factors. These mechanisms are interconnected with each other, and they have been implicated in tumor progression.[24] Studies have recently established the fact that epigenetic inactivation of critical genes exerts an influence on human pathologies such as cancers.[25] Therefore, epigenetics has paved a way to understand the key process through which various therapeutic agents can aid in the treatment of cancer. In this aspect, dietary phytochemicals, such as curcumin, have become evident in reverting the epigenetic modifications and in delineating the molecular targets involved in carcinogenesis.

Addition of indole group to the parent curcumin molecule has given rise to a new analog (indole curcumin) with increased solubility, biological activity, and possibility in reaching the appropriate target.[26],[27] The study further explored the potential role of indole curcumin analog in activating genes involved in cell cycle regulation and apoptosis induction. The influence that the drug has on the methylation status of gene promoter sequence of the ATM gene is also of great significance. Indole curcumin being an analog of curcumin promises to be a very useful drug molecule having various potential targets. The target selected for this study was DNMT1 enzyme and the drug seems to actually show the effects; it was predicted to be having on the target molecule.

MTT assay was performed to assess the cytotoxic effects of the drug on cancer cells. From the result, with increasing concentration of indole curcumin, there was a clear decline in the percentage of viable cells in a dose-dependent manner. The IC50 of indole curcumin on HEp-2 cells was found to be 24 μg/ml after 48 h of incubation. The LDH assay was performed to assess the release of LDH into the media as a marker of dead cells. The media taken from the plate treated with higher dosage concentration of the drug showed higher LDH activity. This justifies the MTT results and verifies that at higher concentrations indole curcumin shows higher cytotoxic activity. Since the drug has been established to have a cytotoxic effect on the HEp-2 cells, it was important to determine whether the cytotoxicity triggers apoptosis or necrosis-mediated death. To test the same, fluorescence imaging using different stains was done.

Acridine orange and EtBr are used in conjunction to differentiate between viable, apoptotic and necrotic cells on the basis of membrane integrity. The distinction is done based on the fact that the live cells appear green and the dead or apoptotic ones appear orange when stained with AcOr/EtBr.[28] The HEp-2 cell samples treated with indole curcumin showed more number of cells with red/orange fluoresced nuclei in comparison to control cells when stained using AcOr/EtBr stain. This proves that indole curcumin triggers apoptosis in HEp-2 cells. To confirm these results another staining procedure, staining with Hoechst 33342 stain was performed. Hoechst stain belongs to a family of blue fluorescent dyes that stain DNA.[29] After staining with Hoechst 33342, the treated cells showed fragmented DNA in their nuclei when fluoresced under UV light depicting the beginning of apoptosis. In comparison with the control, the drug-treated cells have higher occurrence of fragmented DNA in the nuclei of the cells, thus proving that indole curcumin triggers apoptosis-mediated death in HEp-2 cells.

Followed by this, the treated samples were analyzed for flow cytometry to determine whether the drug causes cell cycle arrest or not. This experiment was performed since the original aim of the study was to check the activity of indole curcumin in reverting the cancer cell's properties of evading apoptosis and cell cycle checkpoint. The experiment performed under this study proves that indole curcumin exhibits an equivalent G1 phase arrest in HEp-2 cells. It can be deduced from these results that indole curcumin definitely causes cell cycle checkpoint activation. The possible reasons causing this arrest can be explained as follows. It has been mentioned earlier that there are two important checkpoints regulating the cell cycle one being present at the transition from G1 phase to S. There are many genes which are involved in the management of this particular G1-S checkpoint, these include p53 and ATM (the two genes that have been considered under this study).[30] In normal cells, both the genes p53 and ATM recognize DNA damage in the form of double-stranded DNA breaks and stops the cell from entering the S phase thus arresting cell cycle.[31] The working of both these genes is closely related to each other. Throughout the cell cycle, the DNA is scrutinized for any damage or breaks, and once identified, the cells are either arrested at that point for DNA repair or are subjected to apoptotic removal. In normal cells, any double-stranded DNA break leads to activation of ATM gene which causes recruitment of the serine/threonine kinase protein coded by the same. This ATM then phosphorylates p53, BRCA1, CHEK1/2, and many such genes, which activate DNA repair and cause cell cycle arrest.[32],[33] The p53 thus activated causes further activation of many downstream molecules like p21 which inhibit cyclin/CDK activities resulting in cell cycle arrest and subsequent apoptosis induction. p53 downregulates the cyclin A expression and thus prevents the cells from entering the S phase. It also downregulates Bcl2 which is an inhibitor of apoptosis and thus inducing apoptosis. In conclusion, if there is proper expression and function of ATM and p53, these genes together can cause cell cycle arrest and trigger the cell toward apoptosis.

In lieu of the current study, it can be now predicted that this cell cycle arrest was observed on indole curcumin-treated cells because of the reactivation of ATM and p53 genes which in control cells remain inactive and unable to cause apoptosis or cell cycle arrest.

Now, since it has been justified that apoptosis occurs in HEp-2 cells on treatment with indole curcumin, the pathway through which apoptosis might have been triggered was investigated through mRNA expression analysis of certain genes. It was performed for three genes: P53 (the most important TSG of the body), ATM (protein coded by this gene regulated a cell cycle checkpoint between G1 and S phase), and DAPK (a positive regulator of TNFα induced apoptotic pathway).[34],[35],[36] These genes were chosen for this study because all of them have been described to have an epigenetically altered profile in HNSCC cell line,[6] and also, all of them are someway involved in the apoptosis-related signaling pathway. It was observed from the present study that HEp-2 cells which normally have low expression levels of ATM and p53 show a significant increase in the expression of these genes on treatment with indole curcumin. The gene expression levels of DAPK, however, were not affected that significantly. On the basis of these results, it can be predicted that apoptosis triggered in HEp-2 cells on treatment with indole curcumin is not through the pathway involving activation of TNF α death receptor, however, the apoptosis is mediated through ATM and p53 involving pathways. These pathways proceed by first arresting the cell cycle in G1 phase followed by induction of p53-mediated apoptosis. The gene expression analysis thus helped us predict which apoptosis signaling pathway is probably triggered in HEp-2 cells on treatment with the test drug indole curcumin.

Methylation-specific PCRs were done for the ATM gene to confirm whether the activation of genes crucial for apoptosis and cell cycle regulation occurs through epigenetic route or not. It was found that when the bisulfite modified DNA was amplified using primers specific for the ATM promoter region, in the unmethylated state, the treated sample has a greater level of expression than the control sample. However, when the bisulfite modified DNA was amplified using primers specific toward the promoter in its methylated state, the control sample was found to express in a much higher proportion than the treated samples. These observations clearly point toward the fact that in HEp-2 cells on treatment with indole curcumin, the promoter region of the ATM gene undergoes a change and the aberrant hypermethylation that silenced the gene earlier gets reverted such that the gene starts being expressed again. This also explains why the expression levels of ATM increase in HEp-2 cells on treatment with indole curcumin.

It can be predicted to be happening because of the inhibitory effect that indole curcumin has on the DNMT1 enzyme supported by the in silico results. Based on the hypothesis, the in silico docking between the molecular structure of the drug and the PDB structure of the DNMT1 enzyme was performed. The indole curcumin molecule was found to have almost similar interaction with the active site of DNMT1 like curcumin. The docking score and binding energies suggest that indole curcumin also acts as a covalent blocker for the active site of DNMT1 thus reducing its capability to methylate promoter sequences and silence genes.


 > Conclusion Top


Due to the inhibitory effect of the drug on the most active DNMTs enzyme DNMT1, it is unable to methylate the promoter region and silence the expression of the ATM gene. Thus, in comparison to the normal cells, the indole curcumin-treated cells have a better regulation on the cell cycle and can more efficiently lead cells toward apoptosis. In conclusion, the overall results that were obtained from all the experiments contained in this study suggest that indole curcumin has a potent role in triggering cell cycle arrest followed by apoptosis induction by causing epigenetic activation of ATM gene.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Kozakiewicz P, Grzybowska-Szatkowska L. Application of molecular targeted therapies in the treatment of head and neck squamous cell carcinoma. Oncol Lett 2018;15:7497-505.  Back to cited text no. 1
    
2.
Gaździcka J, Gołąbek K, Strzelczyk JK, Ostrowska Z. Epigenetic modifications in head and neck cancer. Biochem Genet 2020;58:213-44.  Back to cited text no. 2
    
3.
Wang LH, Wu CF, Rajasekaran N, Shin YK. Loss of tumor suppressor gene function in human cancer: An overview. Cell Physiol Biochem 2018;51:2647-93.  Back to cited text no. 3
    
4.
Romanowska K, Sobecka A, Rawłuszko-Wieczorek AA, Suchorska WM, Golusiński W. Head and neck squamous cell carcinoma: Epigenetic landscape. Diagnostics (Basel) 2020;11:E34.  Back to cited text no. 4
    
5.
Aung KL, Siu LL. Genomically personalized therapy in head and neck cancer. Cancers Head Neck 2016;1:2.  Back to cited text no. 5
    
6.
Castilho RM, Squarize CH, Almeida LO. Epigenetic modifications and head and neck cancer: Implications for tumor progression and resistance to Therapy. Int J Mol Sci 2017;18:E1506.  Back to cited text no. 6
    
7.
Cai F, Xiao X, Niu X, Zhong Y. Association between promoter methylation of DAPK gene and HNSCC: A meta-analysis. PLoS One 2017;12:e0173194.  Back to cited text no. 7
    
8.
Zhou C, Ye M, Ni S, Li Q, Ye D, Li J, et al. DNA methylation biomarkers for head and neck squamous cell carcinoma. Epigenetics 2018;13:398-409.  Back to cited text no. 8
    
9.
Kazanets A, Shorstova T, Hilmi K, Marques M, Witcher M. Epigenetic silencing of tumor suppressor genes: Paradigms, puzzles, and potential. Biochim Biophys Acta 2016;1865:275-88.  Back to cited text no. 9
    
10.
Hassan FU, Rehman MS, Khan MS, Ali MA, Javed A, Nawaz A, et al. Curcumin as an alternative epigenetic modulator: Mechanism of action and potential effects. Front Genet 2019;10:514.  Back to cited text no. 10
    
11.
Fabianowska-Majewska K, Kaufman-Szymczyk A, Szymanska-Kolba A, Jakubik J, Majewski G, Lubecka K. Curcumin from turmeric rhizome: A potential modulator of DNA methylation machinery in breast cancer inhibition. Nutrients 2021;13:332.  Back to cited text no. 11
    
12.
Ratovitski EA. Anticancer natural compounds as epigenetic modulators of gene expression. Curr Genomics 2017;18:175-205.  Back to cited text no. 12
    
13.
Mosmann T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J Immunol Methods 1983;65:55-63.  Back to cited text no. 13
    
14.
Hoda M, Pajaniradje S, Shakya G, Mohankumar K, Rajagopalan R. Anti-proliferative and apoptosis-triggering potential of disulfiram and disulfiram-loaded polysorbate 80-stabilized PLGA nanoparticles on hepatocellular carcinoma Hep3B cell line. Nanomedicine 2016;12:1641-50.  Back to cited text no. 14
    
15.
Horrocks JE, King J, Waind AP, Ward J. Lactate dehydrogenase activity in the diagnosis of malignant effusions. J Clin Pathol 1962;15:57-61.  Back to cited text no. 15
    
16.
Mohankumar K, Pajaniradje S, Sridharan S, Singh VK, Ronsard L, Banerjea AC, et al. Apoptosis induction by an analog of curcumin (BDMC-A) in human laryngeal carcinoma cells through intrinsic and extrinsic pathways. Cell Oncol (Dordr) 2014;37:439-54.  Back to cited text no. 16
    
17.
Sun L, Zhu X, Luo J, Wang C, Chen B. Role of DNA damage in the progress of chronic tubule-interstitial injury. Mol Med Rep 2020;22:1081-9.  Back to cited text no. 17
    
18.
Kong WJ, Zhang S, Guo C, Zhang S, Wang Y, Zhang D. Methylation-associated silencing of death-associated protein kinase gene in laryngeal squamous cell cancer. Laryngoscope 2005;115:1395-401.  Back to cited text no. 18
    
19.
Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg GW, et al. A genomic sequencing protocol that yields a positive display of 5-methylcytosine residues in individual DNA strands. Proc Natl Acad Sci U S A 1992;89:1827-31.  Back to cited text no. 19
    
20.
Ai L, Vo QN, Zuo C, Li L, Ling W, Suen JY, et al. Ataxia-telangiectasia-mutated (ATM) gene in head and neck squamous cell carcinoma: Promoter hypermethylation with clinical correlation in 100 cases. Cancer Epidemiol Biomarkers Prev 2004;13:150-6.  Back to cited text no. 20
    
21.
Herman JG, Graff JR, Myöhänen S, Nelkin BD, Baylin SB. Methylation-specific PCR: A novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996;93:9821-6.  Back to cited text no. 21
    
22.
Casalvieri KA, Matheson CJ, Backos DS, Reigan P. Molecular docking of substituted pteridinones and pyrimidines to the ATP-binding site of the N-terminal domain of RSK2 and associated MM/GBSA and molecular field datasets. Data Brief 2020;29:105347.  Back to cited text no. 22
    
23.
Wu R, Wang L, Yin R, Hudlikar R, Li S, Kuo HD, et al. Epigenetics/epigenomics and prevention by curcumin of early stages of inflammatory-driven colon cancer. Mol Carcinog 2020;59:227-36.  Back to cited text no. 23
    
24.
Boyanapalli SS, Kong AT. “Curcumin, the King of Spices”: Epigenetic regulatory mechanisms in the prevention of cancer, neurological, and inflammatory diseases. Curr Pharmacol Rep 2015;1:129-39.  Back to cited text no. 24
    
25.
Kim SY, Han YK, Song JM, Lee CH, Kang K, Yi JM, et al. Aberrantly hypermethylated tumor suppressor genes were identified in oral squamous cell carcinoma (OSCC). Clin Epigenetics 2019;11:116.  Back to cited text no. 25
    
26.
Sufi SA, Adigopula LN, Syed SB, Mukherjee V, Coumar MS, Rao HS, et al. In silico and in vitro anti-cancer potential of a curcumin analogue (1E, 6E)-1, 7-di (1H-indol-3-yl) hepta-1, 6-diene-3, 5-dione. Biomed Pharmacother 2017;85:389-98.  Back to cited text no. 26
    
27.
Sri Ramya PV, Angapelly S, Guntuku L, Singh Digwal C, Nagendra Babu B, Naidu VG, et al. Synthesis and biological evaluation of curcumin inspired indole analogues as tubulin polymerization inhibitors. Eur J Med Chem 2017;127:100-14.  Back to cited text no. 27
    
28.
Liu K, Liu PC, Liu R, Wu X. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med Sci Monit Basic Res 2015;21:15-20.  Back to cited text no. 28
    
29.
Farghadani R, Rajarajeswaran J, Hashim NB, Abdulla MA, Muniandy S. A novel β-diiminato manganeseIII complex as the promising anticancer agent induces G0/G1 cell cycle arrest and triggers apoptosis via mitochondrial-dependent pathways in MCF-7 and MDA-MB-231 human breast cancer cells. RSC Adv 2017;7:24387-98.  Back to cited text no. 29
    
30.
Feroz W, Sheikh AM. Exploring the multiple roles of guardian of the genome: P53. Egypt J Med Hum Genet 2020;21:49.  Back to cited text no. 30
    
31.
Visconti R, Della Monica R, Grieco D. Cell cycle checkpoint in cancer: A therapeutically targetable double-edged sword. J Exp Clin Cancer Res 2016;35:153.  Back to cited text no. 31
    
32.
Huang RX, Zhou PK. DNA damage response signaling pathways and targets for radiotherapy sensitization in cancer. Signal Transduct Target Ther 2020;5:60.  Back to cited text no. 32
    
33.
Lee KW, Tsai YS, Chiang FY, Huang JL, Ho KY, Yang YH, et al. Lower ataxia telangiectasia mutated (ATM) mRNA expression is correlated with poor outcome of laryngeal and pharyngeal cancer patients. Ann Oncol 2011;22:1088-93.  Back to cited text no. 33
    
34.
Aubrey BJ, Kelly GL, Janic A, Herold MJ, Strasser A. How does p53 induce apoptosis and how does this relate to p53-mediated tumour suppression? Cell Death Differ 2018;25:104-13.  Back to cited text no. 34
    
35.
Khaw-On P, Pompimon W, Banjerdpongchai R. Apoptosis induction via ATM phosphorylation, cell cycle arrest, and ER stress by goniothalamin and chemodrugs combined effects on breast cancer-derived MDA-MB-231 cells. Biomed Res Int 2018;2018:1-15.  Back to cited text no. 35
    
36.
Singh P, Ravanan P, Talwar P. Death associated protein kinase 1 (DAPK1): A regulator of apoptosis and autophagy. Front Mol Neurosci 2016;9:46.  Back to cited text no. 36
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7], [Figure 8], [Figure 9], [Figure 10]
 
 
    Tables

  [Table 1]



 

 
Top
 
 
  Search
 
     Search Pubmed for
 
    -  Chandramohan S
    -  Chatterjee O
    -  Pajaniradje S
    -  Subramanian S
    -  Bhat SA
    -  Rajagopalan R
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Conclusion>Article Figures>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed639    
    PDF Downloaded6    

Recommend this journal