Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 
ORIGINAL ARTICLE
Ahead of print publication  

7-geranyloxycoumarin enhanced radiotherapy effects on human gastric adenocarcinoma cells


1 Department of Pharmaceutical Nanotechnology, School of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran
2 Department of Biology, Faculty of Science, Ferdowsi University of Mashhad, Mashhad, Iran
3 Department of Medical Physics, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran
4 Biotechnology Research Center, Pharmaceutical Technology Institute, Mashhad University of Medical Sciences, Mashhad, Iran
5 Novel Diagnostics and Therapeutics Research Group, Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad, Iran

Date of Submission28-Apr-2021
Date of Acceptance03-May-2021
Date of Web Publication27-Aug-2021

Correspondence Address:
Fatemeh B Rassouli,
Novel Diagnostics and Therapeutics Research Group, Institute of Biotechnology, Ferdowsi University of Mashhad, Mashhad
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/jcrt.jcrt_701_21

 > Abstract 


Background: Gastric adenocarcinoma (GA) is a serious malignancy with growing incidence and mortality rate worldwide. The objective of the present study was to determine whether 7-geranyloxycoumarin, a natural monoterpene coumarin, could induce anticancer effects, in single use and/or in combination with anticancer drugs and ionizing radiation, on GA cells. Materials and Methods: 7-geranyloxycoumarin was synthesized by a reaction between 7-hydroxycoumarin and transgeranyl bromide. MKN45 cells were treated with 7-geranyloxycoumarin, and the viability of cells was determined by resazurin. Apoptosis was then evaluated by flow cytometric analysis using annexin V and propidium iodide, and the expression of P53 and BCL2 was analyzed by quantitative polymerase chain reaction (qPCR). Combinatorial effects of 7-geranyloxycoumarin with 5-fluorouracil (5-FU), cisplatin (CDDP), and X radiation were also evaluated. Results: Assessment of cell viability indicated that 7-geranyloxycoumarin induced its toxic effects in a time- and dose-dependent manner. This was confirmed by the detection of apoptotic cells, and qPCR results revealed a significant downregulation in BCL2 expression. Although combinatorial use of 7-geranyloxycoumarin + 5-FU or + CDDP did not improve cytotoxicity of anticancer drugs, significant increase in the effectiveness of applied radiations was detected upon pretreatment with 7-geranyloxycoumarin. Conclusion: Our findings provide valuable insights into single and combinatorial effects of 7-geranyloxycoumarin on the GA cells.

Keywords: 5-fluorouracil, 7-geranyloxycoumarin, cisplatin, gastric cancer, radiotherapy



How to cite this URL:
Movaffagh J, Salari H, Merajifar E, Gholamhosseinian H, Shahroodi A, Iranshahi M, Rassouli FB. 7-geranyloxycoumarin enhanced radiotherapy effects on human gastric adenocarcinoma cells. J Can Res Ther [Epub ahead of print] [cited 2021 Dec 6]. Available from: https://www.cancerjournal.net/preprintarticle.asp?id=324663




 > Introduction Top


According to the latest reports on global burden of cancer, estimations for new cancer cases and related deaths are as 18.1 million and 9.6 million in 2018, respectively.[1] Among deadly neoplasms in the world, gastric cancer is ranked as the fifth most frequently diagnosed cancer and the third for mortality. Epidemiological evidence of gastric adenocarcinoma (GA) indicated high incidence in several Western and Eastern Asian countries, while more than 50% of the new cases occur in developing countries.[2] Incidence of GA mainly depends on Helicobacter pylori infection, while unhealthy diet characterized by low fruit intake, alcohol consumption, and tobacco smoking are also of major importance.[3]

Although eradication of H. pylori infection by vaccination and use of endoscopic screening have declined GA statistics, the survival rate of this disease is still low.[4] Recent clinical evidence suggests that multidisciplinary treatments, including perioperative chemotherapy and chemoradiotherapy after neoadjuvance, increase the benefit of surgery for GA patients.[5] In this regard, a great deal of investigation has focused on natural or synthetic compounds that could enhance anticancer efficacy of chemical agents and/or radiotherapy.

7-geranyloxycoumarin, also known as auraptene, is a monoterpene coumarin found in fruits from Citrus plants. This simple coumarin possesses various pharmaceutical properties, such as antibacterial, antigenotoxic, antioxidative, and anti-inflammatory activities.[6] In addition, cancer chemopreventive effects of 7-geranyloxycoumarin have been shown in several studies,[7],[8],[9] beside reports on its combinatorial effects with anticancer agents and radiotherapy.[10],[11],[12] In the present study, we evaluated anticancer effects of 7-geranyloxycoumarin on GA cells and investigated whether this coumarin could act in combination with chemical drugs and radiotherapy in these cells. In this regard, 7-geranyloxycoumarin was synthesized at first and its IC50 was determined in MKN45 cells. Then, apoptosis was detected by flow cytometric analysis using fluorescein isothiocyanate (FITC)-annexin V and propidium iodide (PI), and the expression of P53 and BCL2 was analyzed by quantitative polymerase chain reaction (qPCR). Moreover, combinatorial effects of 7-geranyloxycoumarin with 5-fluorouracil (5-FU), cisplatin (CDDP), and ionizing radiation were evaluated after 3 time points.


 > Materials and Methods Top


Synthesis of 7-geranyloxycoumarin

7-geranyloxycoumarin [Figure 1]a was synthesized by a reaction between 7-hydroxycoumarin (1 M) and transgeranyl bromide (1.5 M) in the presence of 1,8-diazabicyclo (5.4.0)undec-7-ene (2 M), as previously described.[13] After the mixture was concentrated under reduced pressure, column chromatography (petroleum ether/ethyl acetate 9:1 v/v) was performed to purify 7-geranyloxycoumarin (mp = 62.7°C–63.4°C), and finally, 1H- and 13C-NMR were used to confirm its structure. To prepare different concentrations of 7-geranyloxycoumarin, dimethyl sulfoxide (DMSO) was used as solvent (0.2% and 0.4% v/v).
Figure 1: Chemical structure of 7-geranyloxycoumarin (a). Viability assessment of MKN45 cells after treatment with increasing concentrations of 7-geranyloxycoumarin during 5 consecutive days. (b) *P < 0.05 indicates significant difference with relevant control (0.4% dimethyl sulfoxide). Viability assessment was carried out for at least three times and results are presented as mean ± standard deviation

Click here to view


Treatment of cells

Human GA cells, MKN45 cell line, were obtained from Pasteur Institute (Tehran, Iran) and grown in Dulbecco's modified Eagle's medium (Biowest) supplemented with 10% fetal bovine serum (Biowest) and 1% penicillin-streptomycin (Biowest). Cells were incubated at 37°C and 5% CO2 in air and subcultured by 0.25% trypsin-1 mM EDTA (Biowest).

To determine the IC50 of 7-geranyloxycoumarin, cells were treated 5, 10, 20, and 40 μg/ml of this agent for 24, 48, 72, 96, and 120 h. In addition, the IC50 values of 5-FU and CDDP, anticancer drugs routinely used for GA, were determined by treatment of cells, with increasing concentrations of each drug during 3 consecutive days.

For combinatorial treatment with anticancer drugs, MKN45 cells were treated with 5 μg/ml 7-geranyloxycoumarin + 0.6 and 1.25 μg/ml 5-FU or + 0.6 and 1.25 μg/ml CDDP, all concentrations with low toxicity, for 3 days. In another approach, cells were pretreated with 5, 10, and 20 μg/ml 7-geranyloxycoumarin for 24, 48, and 72 h, followed by radiotherapy using Elekta Compact™ linear accelerator (Crawley) at three different doses (2, 4, and 6 Gy). Finally, cells were recovered for 48 h and assessed for viability.

Viability assessment

Upon treatment of cells with 7-geranyloxycoumarin, alone or in combination, the viability was assessed by resazurin (Sigma) as a colorimetric method. In this regard, resazurin (20 μl/well) was added and cells were incubated at 37°C for 2 h. Then, optical density (OD) of each well was measured at 600 nm and cell viability (%) was calculated as follows: 100 ‒ (TOD ‒ UOD)/(BOD ‒ UOD), in which TOD, UOD, and BOD were OD of treated cells, untreated cells, and blank control, respectively.

Detection of apoptosis

To more study apoptosis-inducing effects of 7-geranyloxycoumarin, MKN45 cells treated with 20 and 30 μg/ml 7-geranyloxycoumarin for 48 h, as well as untreated and DMSO treated cells, were stained by FITC-annexin V and PI (BioLegend). To do so, collected cells were washed and suspended in staining and binding buffers for 20 min at room temperature in the dark, and then, analyzed by flow cytometry (BD Accuri) using FL1 and FL2 filters.

Gene expression analysis

To evaluate the expression of genes involved in apoptosis, the total RNA was extracted from all treatments using an RNA isolation kit (DENAZist). After cDNA was synthesized using M-MuLV reverse transcriptase (ParsToos) according to the manufacturer's instruction, the fidelity of amplified cDNAs was confirmed by PCR using TBP primers (F: ACAACAGCCTGCCACCTTA and R: GAATAGGCTGTGGGGTCAGT). Then, qPCR was conducted in iQ5 real-time PCR detection system (Bio-Rad) using SYBR Green Mix (Ampliqon) and specific primers for P53 (F: GTTCCGAGAGCTGAATGAGG and R: TTATGGCGGGAGGTAGACTG) and BCL2 (F: GATGACTGAGTACCTGAACCG and R: CAGAGACAGCCAGGAGAAATC), while PCR cycling conditions were 94°C for 15 min (94°C for 30 s, 59°C for 30 s, 72°C for 30 s; 45 cycles).

Statistical analysis

Significant level was ascertained by one-way analysis of variance, followed by Tukey multiple comparison test using Graphpad Prism software (San Diego, California, USA). The results were expressed as mean ± standard deviation, and P < 0.05 and 0.01 was considered to be statistically significant.


 > Results Top


To study single and combinatorial effects of 7-geranyloxycoumarin on MKN45 cells, at first, this coumarin derivative was synthesized and its IC50 values were determined during 5 consecutive days, which were >40 μg/ml after 24 h and <40 μg/ml after 48, 72, 96, and 120 h [Figure 1]b. Afterward, apoptosis induced by 7-geranyloxycoumarin was evaluated upon 48 h treatment. [Figure 2]a shows the effects of 20 and 30 μg/ml 7-geranyloxycoumarin on the percentage of alive, necrotic, and early and late apoptotic cells in comparison with their relevant control (0.4% DMSO) and untreated cells. As presented, almost 10% increase was observed in the percentage of late apoptotic cells upon administration of 30 μg/ml 7-geranyloxycoumarin, while this amount was only as 3% for 20 μg/ml 7-geranyloxycoumarin. We also analyzed the expression of genes involved in apoptosis upon 7-geranyloxycoumarin treatment [Figure 2]b. Results of qPCR indicated no significant change in the expression of P53 when cells were treated with 7-geranyloxycoumarin for 48 h, while a significant downregulation of BCL2 expression was detected upon administration of 30 μg/ml 7-geranyloxycoumarin. Taken together, obtained results indicated that 7-geranyloxycoumarin induced low toxic effects on MKN45 cells in concentrations ≤20 μg/ml, and thereby, this agent could be used in such range of dose in combinatorial treatments.
Figure 2: Apoptosis detected by fluorescein isothiocyanate-annexin V and propidium iodide upon different treatments (a). Flow cytometry analysis differentiated alive and necrotic cells from early and late apoptotic cells. Quantitative polymerase chain reaction analysis of P53 and BCL2 expression 48 h after treatment of MKN45 cells (b). To note, relative expression was compared with untreated cells and *P < 0.05 indicates significant difference with no treatment

Click here to view


In the next part of our study, we investigated whether 7-geranyloxycoumarin could act in combination with chemotherapeutic drugs and/or radiotherapy. To do so, the cytotoxicity of 5-FU and CDDP was determined on MKN45 cells during 3 consecutive days. As shown in [Figure 3]a and [Figure 3]b, the IC50 of 5-FU was as >5, 5, and <5 μg/ml after 24, 48, and 72 h, respectively, while the IC50 of CDDP was as >5 μg/ml during all time points. Later on, cells were treated with combination of 7-geranyloxycoumarin (5 μg/ml) +5-FU (0.6 and 1.2 μg/ml) or + CDDP (0.6 and 1.2 μg/ml), all in concentrations lower that their IC50, for 3 continuous days. To note, cells treated with 0.2% DMSO and equal amount of each drug were considered as control. Results of viability assay indicated no significant difference in the percentage of viable cells between test and control groups in all treatments [Figure 3]c and [Figure 3]d.
Figure 3: Cytotoxicity of 5-fluorouracil and cisplatin in MKN45 cells (a and b). Viability assessment of cells upon combinatorial use of 7-geranyloxycoumarin with 5-fluorouracil (c) or cisplatin (d). Cell viability assay was carried out for at least three times and results are presented as mean ± standard deviation

Click here to view


To determine combinatorial effects of 7-geranyloxycoumarin and ionizing radiation, cells were pretreated with 7-geranyloxycoumarin (5, 10, and 20 μg/ml) for 24, 48, and 72 h, and then exposed to various doses (2, 4, and 6 Gy) of X-radiation. Assessment of cell viability after 48 h recovery indicated enhancement in the effectiveness of applied radiations in comparison with relevant control treatments (0.2% DMSO + 2, 4, or 6 Gy). As presented in [Figure 4], pretreatment with 20 μg/ml 7-geranyloxycoumarin for 24, 48, and 72 h significantly (P < 0.01) improved toxicity of 2, 4, and 6 Gy radiation. In addition, 48 and 72 h pretreatment with 10 μg/ml 7-geranyloxycoumarin and then exposure to 4 and 6 Gy radiation culminated in significant (P < 0.05) enhancement in radiotherapy effectiveness. Nevertheless, 5 μg/ml 7-geranyloxycoumarin did not significantly improve the toxicity of applied radiations.
Figure 4: MKN45 cell viability assay upon combinatorial treatment with 7-geranyloxycoumarin and radiotherapy. After pretreatment of cells with 7-geranyloxycoumarin for 24, 48, and 72 h, radiation was applied at 2 Gy (a), 4 Gy (b), and 6 Gy (c), and cells were recovered for 48 h. *P < 0.05, **P < 0.01, indicate significant difference with relevant control (0.2% dimethyl sulfoxide + radiation with similar dose). Viability assessment was carried out for at least three times and results are presented as mean ± standard deviation

Click here to view



 > Discussion Top


GA is a serious malignancy that becomes symptomatic in advanced stages, and therefore, the use of multidisciplinary approaches for its effective treatment is mandatory. To combat distant metastases and local recurrence, complete resection with lymphadenectomy is followed by chemotherapy and radiotherapy, either alone or in combination.[2] In this regard, a great deal of research is being performed to discover natural or synthetic agents with improving effects on systemic cancer therapies.

7-geranyloxycoumarin is a natural bioactive monoterpene coumarin ether with remarkable pharmaceutical activities. Beside studies carried out on various cancer models and cell lines that have proved chemopreventive and anticancer effects of 7-geranyloxycoumarin,[7],[8],[9],[14],[15],[16] our previous attempts indicated that this agent could be used in combinatorial approaches against esophageal and colon cancers.[10],[11],[12],[17] The present study, however, was undertaken to broaden current knowledge regarding combinatorial effects of 7-geranyloxycoumarin on GA, as another gastrointestinal malignancy.

Decreased viability of cells, along with induced apoptosis and downregulation of BCL2, indicated that 7-geranyloxycoumarin acts in a dose-dependent manner and induced its toxic effects on MKN45 cells in concentrations ≥30 μg/ml. Worth to note, we have previously determined the IC50 of 7-geranyloxycoumarin on noncancerous human fibroblasts as >80 mg/ml.[11] In consistence with our findings, it has been reported that 7-geranyloxycoumarin induced cytotoxicity by up and downregulating apoptosis mediators BAX and BCL2, respectively.[18],[19],[20]

In combinatorial approaches, 7-geranyloxycoumarin did not affect cytotoxicity of 5-FU and CDDP, presumably since this agent did not interact with relevant transporters, such as MRP2 and MRP5, in MKN45 cells.[21],[22] Nevertheless, pretreatment of cells with 7-geranyloxycoumarin significantly improved effectiveness of radiotherapy. As reported previously, radiation induced the expression of cell cycle inhibitor P21, and pretreatment with 7-geranyloxycoumarin increased P21 expression to higher levels.[10],[23] Furthermore, it has been shown that downregulation of GATA6 by 7-geranyloxycoumarin promoted radiation-induced apoptosis.[10],[24] Accordingly, increased toxicity of radiotherapy upon 7-geranyloxycoumarin pretreatment might be, to some extent, due to induced changes in the expression of P21 and GATA6, although more investigation is required to determine the exact mechanism.


 > Conclusion Top


The current study provided evidence, for the first time, that low toxic 7-geranyloxycoumarin improved cytotoxicity of ionizing radiation in the GA cells. Since enhanced effectiveness of radiotherapy would have great impact on clinical outcomes, 7-geranyloxycoumarin could be considered a valuable therapeutic agent in future combinatorial modalities.

Financial support and sponsorship

This study was financially supported by a grant from Mashhad University of Medical Sciences (No. 940871).

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018;68:394-424.  Back to cited text no. 1
    
2.
Sitarz R, Skierucha M, Mielko J, Offerhaus GJ, Maciejewski R, Polkowski WP. Gastric cancer: Epidemiology, prevention, classification, and treatment. Cancer Manag Res 2018;10:239-48.  Back to cited text no. 2
    
3.
Rawla P, Barsouk A. Epidemiology of gastric cancer: Global trends, risk factors and prevention. Prz Gastroenterol 2019;14:26-38.  Back to cited text no. 3
    
4.
Balakrishnan M, George R, Sharma A, Graham DY. Changing trends in stomach cancer throughout the world. Curr Gastroenterol Rep 2017;19:36.  Back to cited text no. 4
    
5.
Toneto MG, Viola L. Current status of the multidisciplinary treatment of gastric adenocarcinoma. Arq Bras Cir Dig 2018;31:e1373.  Back to cited text no. 5
    
6.
Genovese S, Epifano F. Auraptene: A natural biologically active compound with multiple targets. Curr Drug Targets 2011;12:381-6.  Back to cited text no. 6
    
7.
Tanaka T, de Azevedo MB, Durán N, Alderete JB, Epifano F, Genovese S, et al. Colorectal cancer chemoprevention by 2 beta-cyclodextrin inclusion compounds of auraptene and 4'-geranyloxyferulic acid. Int J Cancer 2010;126:830-40.  Back to cited text no. 7
    
8.
Kohno H, Suzuki R, Curini M, Epifano F, Maltese F, Gonzales SP, et al. Dietary administration with prenyloxycoumarins, auraptene and collinin, inhibits colitis-related colon carcinogenesis in mice. Int J Cancer 2006;118:2936-42.  Back to cited text no. 8
    
9.
Krishnan P, Yan KJ, Windler D, Tubbs J, Grand R, Li BD, et al. Citrus auraptene suppresses cyclin D1 and significantly delays N-methyl nitrosourea induced mammary carcinogenesis in female Sprague-Dawley rats. BMC Cancer 2009;9:259.  Back to cited text no. 9
    
10.
Moussavi M, Haddad F, Rassouli FB, Iranshahi M, Soleymanifard S. Synergy between auraptene, ionizing radiation, and anticancer drugs in colon adenocarcinoma cells. Phytother Res 2017;31:1369-75.  Back to cited text no. 10
    
11.
Saboor-Maleki S, Rassouli FB, Matin MM, Iranshahi M. Auraptene attenuates malignant properties of esophageal stem-like cancer cells. Technol Cancer Res Treat 2017;16:519-27.  Back to cited text no. 11
    
12.
Salari H, Afkhami-Poostchi A, Soleymanifard S, Nakhaei-Rad S, Merajifar E, Iranshahi M, et al. Coadministration of auraptene and radiotherapy; a novel modality against colon carcinoma cells in vitro and in vivo. Int J Radiat Biol 2020;96:1051-9.  Back to cited text no. 12
    
13.
Askari M, Sahebkar A, Iranshahi M. Synthesis and purification of 7-prenyloxycoumarins and herniarin as bioactive natural coumarins. Iran J Basic Med Sci 2009;12:63-9.  Back to cited text no. 13
    
14.
Moon JY, Kim H, Cho SK. Auraptene, a major compound of supercritical fluid extract of phalsak (Citrus Hassaku Hort ex Tanaka), induces apoptosis through the suppression of mTOR pathways in human gastric cancer SNU-1 cells. Evid Based Complement Alternat Med 2015;2015:402385.  Back to cited text no. 14
    
15.
Epifano F, Genovese S, Miller R, Majumdar AP. Auraptene and its effects on the re-emergence of colon cancer stem cells. Phytother Res 2013;27:784-6.  Back to cited text no. 15
    
16.
Jun DY, Kim JS, Park HS, Han CR, Fang Z, Woo MH, et al. Apoptogenic activity of auraptene of Zanthoxylum schinifolium toward human acute leukemia Jurkat T cells is associated with ER stress-mediated caspase-8 activation that stimulates mitochondria-dependent or -independent caspase cascade. Carcinogenesis 2007;28:1303-13.  Back to cited text no. 16
    
17.
Moussavi M, Haddad F, Matin MM, Iranshahi M, Rassouli FB. Efficacy of hyperthermia in human colon adenocarcinoma cells is improved by auraptene. Biochem Cell Biol 2018;96:32-7.  Back to cited text no. 17
    
18.
Mousavi SH, Davari AS, Iranshahi M, Sabouri-Rad S, Tayarani Najaran Z. Comparative analysis of the cytotoxic effect of 7-prenyloxycoumarin compounds and herniarin on MCF-7 cell line. Avicenna J Phytomed 2015;5:520-30.  Back to cited text no. 18
    
19.
Lee JC, Shin EA, Kim B, Kim BI, Chitsazian-Yazdi M, Iranshahi M, et al. Auraptene induces apoptosis via myeloid cell leukemia 1-mediated activation of caspases in PC3 and DU145 prostate cancer cells. Phytother Res 2017;31:891-8.  Back to cited text no. 19
    
20.
Afshari AR, Karimi Roshan M, Soukhtanloo M, Ghorbani A, Rahmani F, Jalili-Nik M, et al. Cytotoxic effects of auraptene against a human malignant glioblastoma cell line. Avicenna J Phytomed 2019;9:334-46.  Back to cited text no. 20
    
21.
Sprowl JA, Ness RA, Sparreboom A. Polymorphic transporters and platinum pharmacodynamics. Drug Metab Pharmacokinet 2013;28:19-27.  Back to cited text no. 21
    
22.
Wang WB, Yang Y, Zhao YP, Zhang TP, Liao Q, Shu H. Recent studies of 5-fluorouracil resistance in pancreatic cancer. World J Gastroenterol 2014;20:15682-90.  Back to cited text no. 22
    
23.
Sanli T, Rashid A, Liu C, Harding S, Bristow RG, Cutz JC, et al. Ionizing radiation activates AMP-activated kinase (AMPK): A target for radiosensitization of human cancer cells. Int J Radiat Oncol Biol Phys 2010;78:221-9.  Back to cited text no. 23
    
24.
Cai WS, Shen F, Li JL, Ying ZF, Huan CW, Xu XB. Activated protease receptor-2 induces GATA6 expression to promote survival in irradiated colon cancer cells. Arch Biochem Biophys 2014;555-556:28-32.  Back to cited text no. 24
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]



 

 
Top
 
 
  Search
 
     Search Pubmed for
 
    -  Movaffagh J
    -  Salari H
    -  Merajifar E
    -  Gholamhosseinian H
    -  Shahroodi A
    -  Iranshahi M
    -  Rassouli FB
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

  >Abstract>Introduction>Materials and Me...>Results>Discussion>Conclusion>Article Figures
  In this article
>References

 Article Access Statistics
    Viewed235    
    PDF Downloaded2    

Recommend this journal