Home About us Editorial board Ahead of print Current issue Search Archives Submit article Instructions Subscribe Contacts Login 

 
ORIGINAL ARTICLE
Ahead of print publication  

Evaluation of promoter hypermethylation of tumor suppressor gene BRCA1 in epithelial ovarian cancer


1 Department of Biochemistry, Maulana Azad Medical College, New Delhi, India
2 Department of Obstetrics and Gynaecology, Maulana Azad Medical College, New Delhi, India
3 Department of Biochemistry, All India Institute of Medical Sciences, Nagpur, Maharashtra, India
4 Department of Biochemistry, All India Institute of Medical Sciences, Bhopal, Madhya Pradesh, India
5 Department of Pathology, Maulana Azad Medical College, New Delhi, India

Date of Submission08-Apr-2020
Date of Decision31-May-2020
Date of Acceptance15-Sep-2020
Date of Web Publication20-Aug-2021

Correspondence Address:
Dnyanesh B Amle,
Department of Biochemistry, All India Institute of Medical Sciences, Plot No. 2, Sector 20, MIHAN, Nagpur - 441 108, Maharashtra
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/jcrt.JCRT_390_20

 > Abstract 


Context: Epithelial ovarian cancer (EOC) is a serious gynecological issue worldwide and its late detection is the major encumbrance in treatment procedures. Hypermethylation-mediated BRCA1 gene silencing results in failure of the repair system of damaged DNA playing an important role in ovarian carcinogenesis. BRCA1 gene hypermethylation can serve as a safe and highly specific clinical marker for EOC.
Aims: The present study was conducted to evaluate the promoter hypermethylation of BRCA1 gene in EOC patients.
Settings and Design: This hospital-based case–control study carried out in the tertiary care hospital in New Delhi.
Subjects and Methods: Promoter hypermethylation of BRCA1 gene was examined in 30 EOC diagnosed untreated cases confirmed by histopathological examinations and compared with 30 normal healthy controls matched for age using methylation specific-polymerase chain reaction.
Results: We found significantly higher BRCA1 promoter hypermethylation in the serum of EOC cases as compared to controls with P < 0.0001. BRCA1 gene methylation was found to have 70% sensitivity for the diagnosis of EOC with 100% specificity. A significant difference was observed in the range of CA125 levels, B12 and Folate levels between EOC cases and controls.
Conclusions: We conclude that BRCA1 gene is significantly hypermethylated in EOC patients and thus can prove to be a noninvasive diagnostic tool. Our results provide prefatory evidence that epithelial ovarian epigenome can be influenced by dietary nutrients.

Keywords: B12, BRCA1, CA125, epithelial ovarian cancer, folic acid, promoter hypermethylation, tumor suppressor gene



How to cite this URL:
Das J, Chandra L, Gandhi G, Amle DB, Patnayak RL, Khurana N, Saxena A. Evaluation of promoter hypermethylation of tumor suppressor gene BRCA1 in epithelial ovarian cancer. J Can Res Ther [Epub ahead of print] [cited 2021 Dec 5]. Available from: https://www.cancerjournal.net/preprintarticle.asp?id=324165




 > Introduction Top


Epithelial ovarian cancer (EOC), a predominant cause of all gynecological malignancies,[1],[2] is a result of multiple environmental, epigenetic, and genetic events over time. BRCA1, a tumor suppressor gene, plays an important role in surveillance of cell cycle and repair of DNA damage.[3] Hypermethylation of BRCA1promoter leads to inactivation of BRCA1 expression that results in failure of repair mechanisms of damaged DNA and thus increases the risk of cancer.[4] The identification of tumors exhibiting BRCA1 defects has therapeutic and prognostic significance and they represent potential biomarkers for diagnosis, staging, prognosis, and monitoring of response to therapy (predictive biomarkers).[5],[6]

Given that epigenetic alterations are reversible and occur early in cancer development, dietary interventions may offer promising avenues for cancer prevention.[7],[8],[9] However, data relating to circulating levels of folate and Vitamin B12 association with promoter hypermethylation of tumor suppressor gene in ovarian cancer patients are very limited. Hence, our study along with the detection of biomarkers for the early diagnosis of ovarian cancer also focused on micronutrients-folate and Vitamin B12 association with promoter hypermethylation of tumor suppressor genes in ovarian cancer patients.


 > Subjects And Methods Top


Study subjects

This hospital-based case–control study was carried out in a tertiary care hospital in New Delhi. The study subjects included 30 adult female cases with EOC and 30 clinically normal healthy women controls matched for age. All the cases included in the study were newly diagnosed, untreated patients with EOC confirmed by histopathological examination. Subjects with concurrent cancer on any other site or those who underwent chemotherapy or radiotherapy for EOC were excluded from the study. In addition, subjects with a history of familial ovarian or breast carcinoma in 1st relatives were not included in controls.

Out of total 30 subjects, 17 subjects (56.7%) were of mucinous adenocarcinoma, 6 (20%) were of serous adenocarcinoma and papillary carcinoma each and one subject (3.3%) belonged to clear cell adenocarcinoma variety of ovarian cancer.

Written informed consent was obtained from all subjects before enrolling them in the study. This study was approved by the institutional ethical committee and was conducted in accordance with the Declaration of Helsinki.

Methylation-specific polymerase chain reaction

In a plain, vial 5 mL blood sample was collected from cases and controls by venepuncture after informed consent and serum was isolated by centrifugation. Total Genomic DNA isolated from serum using FitAmp™ Plasma/Serum DNA Isolation Kit (Epigentek Group Inc.,) and from embedded epithelial ovarian cancerous tissue sections using Genomic DNA Mini Kit (GeneaidBiotec Ltd.) were subjected to bisulfite treatment using BisulFlash™ DNA Modification Kit obtained from Epigentak. This was followed by methylated specific polymerase reaction (MSP) to analyze the promoter methylation status of BRCA1 gene. MSP reaction was performed using specific primers for unmethylated and methylated DNA. Primers for unmethylated BRCA1 gene were F: 5'GGTTAATTTAGAGTTTTGAGAGATG3' and R: 5'TCAACAAACTCACACCCACCAATCA3'. While primers for methylated BRCA1 gene were as follows-F: 5'GGTTAATTTAGAGTTTCGAGAGACG3' and R: 5'TCAACGAACTCACGCCGCGCAATCG3'. The amplification was performed for 40 cycles at 53.5°C annealing temperature and the products were resolved using electrophoresis in 2% agarose gel stained with ethidium bromide and visualized under ultraviolet illumination.

Biochemical estimations

Electrochemiluminescence-based immunoassay technique was used for the estimation of serum CA125, Folic acid, Vitamin B12. The estimation was done on the fully automated electrochemiluminescence analyzer (ELECSYS 2010, Hitachi High Technologies Corporation, and Tokyo, Japan).

Statistical analysis

Data were expressed as mean ± standard deviation and percentage. Student's t-test was used to check the significance of the difference between two parameters in parametric data. Fischer's exact test or Chi-square test was used to analyze the significance of the difference between the frequency distribution of the data. Statistically significance was assigned at P = 0.05. IBM SPSS Statistics for Windows, Version 21.0. Armonk, NY, USA: IBM Corp was used for analysis.


 > Results Top


Baseline characteristics of study subjects were observed [Table 1]. Both, the cases and controls were found to be matched with age and their menopausal status. To know the effect of methylation on clinicopathological features, cases were divided according to FIGO staging of EOC, histopathological types and histopathological grade. In this study, the highest numbers of cases belonged to Stage III (56.7%) followed by, Stage I (20%), Stage IV (16.7%), and Stage II (6.7%). BRCA1 promoter methylation in serum was found to be significantly higher in EOC patients as compared to controls (P < 0.0001).
Table 1: Baseline characteristics of study subjects

Click here to view


Methylation of BRCA1 gene was found to have 70% sensitivity for the diagnosis of EOC and the specificity was 100%. Positive predictive value for the gene was observed as 100% while negative predictive value was 76.92% [Table 2].
Table 2: Diagnosticsignificanceofpromoterhypermethylationof BRCA1 gene

Click here to view


The frequency of methylation of BRCA1 in DNA isolated from serum and tissue respectively was 21 (70%) and 22 (73.3%). The association of the methylation status of BRCA1 gene with baseline characteristics of EOC cases was performed using Fischer's exact test. The frequency of methylation status was found to be matched in serum as well as in tissue concerning menopausal stage and clinical staging. However, we observed a statistically significant association of methylation frequency of BRCA1 gene isolated from serum as well from tissue for histological grading of tumor [Table 3].
Table 3: Association of methylation status of BRCA1 gene with baseline characteristics of epithelial ovarian cancer cases

Click here to view


Statistically significant difference was observed in CA125 levels, Vitamin B12 and Folate levels between EOC cases and controls [Table 4]. All the biochemical parameters were found to be matched for BRCA1 methylation [Table 5].
Table 4: Comparison of biochemical parameters in epithelial ovarian cancer cases and controls

Click here to view
Table 5: Serum CA 125 levels in BRCA1 methylation positive and methylation negative cases in serum (epithelial ovarian cancer patients)

Click here to view



 > Discussion Top


Ovarian cancer is an important cause of morbidity and mortality and one of the most common cancers worldwide. The absolute number of new cancer patients in India is increasing rapidly. EOC ranked as the third most common neoplasm in Mumbai women by the year 2000 and accounted for about 7% of the cancer incidence in the population.[10] Another study conducted by Takiar and Vijay showed that the pooled cancer cases in women among five urban centers (Bangalore, Bhopal, Chennai, Delhi and Mumbai) increased from 29,447 cases in 1988–90 to 48,472 cases in 2003–05 registering an increase of about 63.3% and ovarian cancer contributed to 8.0% of change.[11] Late presentation and poor prognosis of the disease is the major impediment in the development of specific and sensitive screening methods.

There are several advantages of using DNA methylation as a clinical biomarker. Compared with protein-based biomarkers, DNA methylation is amplifiable and can be detected easily by polymerase chain reaction (PCR) based methods. In this study we have emphasized on BRCA1 gene that provides instructions for protein with tumor suppressor nature and the gene is also involved in repairing damaged DNA. Biallelic inactivation causes loss of expression of tumor suppressor genes and promoter methylation plays a significant role in silencing BRCA1.[12],[13],[14] Detection of BRCA1 hypermethylation, in ovarian cancer patient's serum, may represent a minimally invasive approach for early diagnosis and predicting patient's response to standard therapies. Besides, early detection of ovarian cancer using this strategy can increase the chances of survival and curative therapy. Several studies were dedicated to explore its frequency and correlation with the disease characteristics. However, the efforts so far failed to outline such a phenotype, as the available data are too heterogeneous regarding frequency and clinical correlations also are contradictory. Our study extends the previous research and is consistent with the observations that promoter methylation of BRCA1plays an important role in functional inactivation of BRCA1which might play an important role in ovarian carcinogenesis.

We investigated BRCA1 promoter hypermethylation in both cases and control groups. Significantly higher prevalence of BRCA1 promoter methylation in serum as compared to controls (P value <0.0001 suggests that abnormal methylation of BRCA1 is tumor specific. Manchana et al. conducted a study on BRCA mutation in a high grade epithelial cancer and found that the frequency of germline BRCA mutation was 19 in 87 patients (21.8%).[15] Ibanez de Caceres et al. found a much lower frequency of promoter hypermethylation ofBRCA1, i.e., 12 of 50 (24%) but, they did not observe hypermethylation of the gene panel in serum DNA from 20 normal, healthy age-matched women, similar to our study.[16] Shilpa et al. conducted a study on Indian population and found a comparatively higher frequency of hypermethylation of BRCA1 gene (51.2%) in ovarian cancer patients in Indian cohort.[17]

Statistically significant correlation was seen in the methylation status of genes in serum and paired tissue samples of EOC cases. Out of 30 subjects, 73.3% of subjects showing positive methylation in cancer tissue and 70% with positive methylation in serum as well, suggests fine homogeneity in gene methylation detection between serum and tissue. This may be because apoptosis or necrosis did not occur in cancer tissue or that circulating DNA content from tumor cells is too little to be detected by MSP or because of unknown reasons yet to be investigated. Possibly, a higher number of cycles or a two-stage (nested) MSP approach would have resulted in the positive detection of hypermethylation in the negative serum DNA. Ibanez de Caceres et al. investigated the hypermethylation status of the same genes in the matched serum and peritoneal fluid DNA and compared the pattern of gene hypermethylation found to that of the corresponding tumor DNA. They detected an identical pattern of gene hypermethylation in 41 of 50 (82%) matched serum or plasma DNA. A gene negative for hypermethylation in the tumor DNA was always negative in the matched serum or peritoneal fluid DNA, similar to our study.[16]

BRCA1 methylation achieved 70% sensitivity but 100% specificity in EOC patients when compared with healthy controls. Several factors may account for the difference in the frequency of hypermethylation: the applied methodological approaches and the scale of studied groups, adjacent normal tissue contamination, partial hypermethylation, population differences due to exposure to specific environmental agents and others or maybe because MSP detects differential methylation status by amplification of bisulfite-treated DNA with primers specific for methylated versus unmethylated DNA. No significant association between the BRCA1 methylation and clinicopathological parameters including menopausal status and staging was observed. Hypermethylation was found in patients of all ages as well as in all pathological grades and stages of ovarian cancer examined, including well-differentiated Stage I A/B tumors. Thus, promoter hypermethylation of the tumor suppressor genes can be a relatively early event in ovarian tumorigenesis which is independent of age or menopausal status of patient and stage of cancer.

Significant association between methylation status of BRCA1 and histological grading of tumor was observed in serum (P = 0.007) as well as in tissue (P = 0.003), which is similar to findings of the study conducted by Shilpa et al.[17],[18] On contrary, Wang et al. found significant difference in the BRCA1 promoter methylation levels between different ovarian cancer stages. Compared to Stage I and the control groups, there were higher BRCA1 promoter methylation frequencies in Stage II and III ovarian cancers.[19] BRCA1 methylation correlated with the loss of BRCA1expression. BRCA1promoter in stage I tumors showed hypomethylation by quantitative PCR.

The association of tumor marker for EOC patients and biochemical parameters namely CA 125, Vitamin B12, and folic acid levels in serum with the methylation status of tumor suppressor gene BRCA1in EOC patients was investigated. CA 125 levels in EOC cases were found to be significantly elevated in comparison to serum CA125 levels in normal controls (P < 0.0001). Cases with advanced Stage (III and IV) showed elevated CA125 levels compared to those in the early stage of cancer (I and II), though it was not statistically significant (P = 0.1). Similarly, no significant relationship between the grade of tumor and serum level of CA125 was observed. A study conducted by Atacag showed that patients with preoperative greater elevations of CA 125 levels had more advanced stage disease and higher-grade tumors.[20] The author concluded the presence of high CA 125 may be used as a prognostic factor in the management of women with adnexal masses.

The epigenetic ability of dietary compounds in cancer cells can have important implications for cancer prevention. The goal is to achieve some degree of epigenetic reprogramming to maintain normal gene expression status and reverse tumorigenesis through chemoprevention or lifestyle intervention such as diet modification. Increasing evidence suggests that certain constituents in food and dietary supplements can influence the epigenome and ultimately, individual risk of developing cancer. Among such compounds, micronutrients in folate mediated one-carbon metabolism are of particular interest.[21] In folic acid deficiency S-adenosyl methionine, SAM is reduced, and synthesis, methylation and repair of DNA are also hampered. The resulting DNA instability increases the risk of cancer development.[22],[23]

Over the past years, however, there have been rising concerns that folic acid supplementation actually could increase the risk of cancer.[24],[25] Combined analysis of the two Norwegian randomized controlled clinical trials with extended post-trial follow-up, demonstrated an increased incidence of cancer among patients taking folic acid for homocysteine reduction as secondary prevention of cardiovascular events.[26],[27] Collin et al. have shown Vitamin B12 and folate were associated with increased prostate cancer risk.[28] In our study, EOC patients had a significantly higher level of serum Vitamin B12 than controls. The difference was statistically significant (with P = 0.001). Median levels of serum folic acid in cases (16.95 ng/mL) were significantly higher than in the control group (8 ng/mL) with a P < 0.0001. To the best of our knowledge, there are no other studies with similar findings.

Although not uniformly consistent, majority of studies showed an inverse relationship between the dietary intake and blood levels of folate and risk of malignancy in a large body of epidemiologic studies. Our results provide preliminary evidence that dietary nutrients might influence the ovarian cancer epigenome. Known epigenetic alterations are reversible and occur early in cancer development, dietary interventions will possibly offer favorable avenues for cancer prevention. Further studies on a larger population are required to establish an association between methylation status and serum B12 and folic acid levels in EOC. Matsuo et al. in a recent retrospective case study suggested that salvage treatment with nivolumab monotherapy is well tolerated and prolonged benefit in women with recurrent EOC with BRCA mutation may be achieved.[29]


 > Conclusions Top


BRCA1 gene promoter methylation is found to be hypermethylated in a significant percentage of EOC. However, the sample size of the study is too modest to arrive at any definitive conclusion and these results are due to be confirmed in larger studies. If so proved, promoter hypermethylation may have useful clinical application in ovarian cancer detection and management. To further add to the importance, such a blood-borne screening test can be a convenient and less expensive diagnostic tool.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
 > References Top

1.
Jemal A, Siegel R, Ward E, Hao Y, Xu J, Thun MJ. Cancer statistics, 2009. CA Cancer J Clin 2009;59:225-49.  Back to cited text no. 1
    
2.
Kim SI, Lee M, Kim HS, Chung HH, Kim JW, Park NH, et al. Effect of BRCA mutational status on survival outcome in advanced-stage high-grade serous ovarian cancer. J Ovarian Res 2019;12:40.  Back to cited text no. 2
    
3.
Teng LS, Zheng Y, WangHH. BRCA1/2 associated hereditary breast cancer. J. Zhejiang Uni Sci B 2008;9:85-9.  Back to cited text no. 3
    
4.
Baldwin RL, Nemeth E, Tran H, Shvartsman H, Cass I, Narod S, et al. BRCA1 promoter region hypermethylation in ovarian carcinoma: A population-based study. Cancer Res 2000;60:5329-33.  Back to cited text no. 4
    
5.
Laird PW. The power and the promise of DNA methylation markers. Nat Rev Cancer 2003;3:253-66.  Back to cited text no. 5
    
6.
Bai X, Fu Y, Xue H, Guo K, Song Z, Yu Z, et al. BRCA1 promoter hypermethylation in sporadic epithelial ovarian carcinoma: Association with low expression of BRCA1, improved survival and coexpression of DNA methyltransferases. Oncol Lett 2014;7:1088-96.  Back to cited text no. 6
    
7.
Friso S, Choi SW. Gene-nutrient interactions and DNA methylation. J Nutr 2002;132:2382S-7S.  Back to cited text no. 7
    
8.
Davis CD, Uthus EO. DNA methylation, cancer susceptibility, and nutrient interactions. Exp Biol Med (Maywood) 2004;229:988-95.  Back to cited text no. 8
    
9.
Kim YI. Does a high folate intake increase the risk of breast cancer? Nutr Rev 2006;64:468-75.  Back to cited text no. 9
    
10.
Kavarana NM, Kamat MR, Kurkure AP, Yeole BB, Sunny L. Cancer Morbidity and Mortality in Greater Mumbai. Mumbai Cancer Registry, National Cancer Registry Project: Indian Council of Medical Research; 2000.  Back to cited text no. 10
    
11.
Takiar R, Vijay CR. An alternative approach to study the changes in the cancer pattern of women in India (1988-2005). Asian Pac J Cancer Prev 2010;11:1253-6.  Back to cited text no. 11
    
12.
Knudson AG Jr. Hereditary cancer, oncogenes, and antioncogenes. Cancer Res 1985;45:1437-43.  Back to cited text no. 12
    
13.
Esteller M, Silva JM, Dominguez G, Bonilla F, Matias-Guiu X, Lerma E, et al. Promoter hypermethylation and BRCA1 inactivation in sporadic breast and ovarian tumors. J Natl Cancer Inst 2000;92:564-9.  Back to cited text no. 13
    
14.
Geisler JP, Hatterman-Zogg MA, Rathe JA, Buller RE. Frequency of BRCA1 dysfunction in ovarian cancer. J Natl Cancer Inst 2002;94:61-7.  Back to cited text no. 14
    
15.
Manchana T, Phoolcharoen N, Tantbirojn P. BRCA mutation in high grade epithelial ovarian cancers. Gynecol Oncol Rep 2019;29:102-5.  Back to cited text no. 15
    
16.
Ibanez de Caceres I, Battagli C, Esteller M, Herman JG, Dulaimi E, Edelson MI, et al. Tumor cell-specific BRCA1 and RASSF1A hypermethylation in serum, plasma, and peritoneal fluid from ovarian cancer patients. Cancer Res 2004;64:6476-81.  Back to cited text no. 16
    
17.
Shilpa V, Bhagat R, Premalata CS, Pallavi VR, Ramesh G, Krishnamoorthy L. BRCA1 promoter hypermethylation and protein expression in ovarian carcinoma – An Indian study. Tumour Biol 2014;35:4277-84.  Back to cited text no. 17
    
18.
Kumar SS, Swamy SN, Premalatha CS, Pallavi VR, Gawari R. Aberrant promoter hypermethylation of RASSF1a and BRCA1 in circulating cell-free tumor DNA serves as a biomarker of ovarian carcinoma. Asian Pac J Cancer Prev 2019;20:3001-5.  Back to cited text no. 18
    
19.
Wang YQ, Yan Q, Zhang JR, Li SD, Yang YX, Wan XP. Epigenetic inactivation of BRCA1 through promoter hypermethylation in ovarian cancer progression. J Obstet Gynaecol Res 2013;39:549-54.  Back to cited text no. 19
    
20.
Atacag T. Diagnostic value of thrombocytosis and high CA 125 level in women with adnexal masses. Eur J Gynaecol Oncol 2012;33:517-20.  Back to cited text no. 20
    
21.
Chen J, Xu X. Diet, epigenetic, and cancer prevention. In Advances in genetics. Academic Press; 2010. p. 237-55.  Back to cited text no. 21
    
22.
Duthie SJ. Folic acid deficiency and cancer: Mechanisms of DNA instability. Br Med Bull 1999;55:578-92.  Back to cited text no. 22
    
23.
Prinz-Langenohl R, Fohr I, Pietrzik K. Beneficial role for folate in the prevention of colorectal and breast cancer. Eur J Nutr 2001;40:98-105.  Back to cited text no. 23
    
24.
Kim YI. Folate and colorectal cancer: An evidence-based critical review. Mol Nutr Food Res 2007;51:267-92.  Back to cited text no. 24
    
25.
Cole BF, Baron JA, Sandler RS, Haile RW, Ahnen DJ, Bresalier RS, et al. Polyp prevention study group. Folic acid for the prevention of colorectal adenomas: A randomized clinical trial. J Am Med Assoc 2007;297:2351-9.  Back to cited text no. 25
    
26.
Bønaa KH, Njølstad I, Ueland PM, Schirmer H, Tverdal A, Steigen T, et al. Homocysteine lowering and cardiovascular events after acute myocardial infarction. N Engl J Med 2006;354:1578-88.  Back to cited text no. 26
    
27.
Ebbing M, Bleie O, Ueland PM, Nordrehaug JE, Nilsen DW, Vollset SE, et al. Mortality and cardiovascular events in patients treated with homocysteine-lowering B vitamins after coronary angiography: A randomized controlled trial. J Am Med Assoc 2008;300:795-804.  Back to cited text no. 27
    
28.
Collin SM, Metcalfe C, Rfsum H, Lewis SJ, Zuccolo L, Smith GD, et al. Circulating folate, vitamin B12, homocysteine, vitamin B12 transport proteins, and risk of prostate cancer: A case-control study, systematic review, and meta-analysis. Cancer Epidemiol Biomarkers Prev 2010;19:1632-42.  Back to cited text no. 28
    
29.
Matsuo K, Spragg SE, Ciccone MA, Blake EA, Ricker C, Pham HQ, et al. Nivolumab use for BRCA gene mutation carriers with recurrent epithelial ovarian cancer: A case series. Gynecol Oncol Rep 2018;25:98-101.  Back to cited text no. 29
    



 
 
    Tables

  [Table 1], [Table 2], [Table 3], [Table 4], [Table 5]



 

 
Top
 
 
  Search
 
     Search Pubmed for
 
    -  Das J
    -  Chandra L
    -  Gandhi G
    -  Amle DB
    -  Patnayak RL
    -  Khurana N
    -  Saxena A
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

  >Abstract>Introduction>Subjects And Methods>Results>Discussion>Conclusions>Article Tables
  In this article
>References

 Article Access Statistics
    Viewed299    
    PDF Downloaded3    

Recommend this journal